ID: 1039263454

View in Genome Browser
Species Human (GRCh38)
Location 8:35798523-35798545
Sequence CAAGGTCACAAATCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039263454_1039263459 24 Left 1039263454 8:35798523-35798545 CCCACTTTGGATTTGTGACCTTG No data
Right 1039263459 8:35798570-35798592 GACAATCATATCCAGTTCACTGG No data
1039263454_1039263460 25 Left 1039263454 8:35798523-35798545 CCCACTTTGGATTTGTGACCTTG No data
Right 1039263460 8:35798571-35798593 ACAATCATATCCAGTTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039263454 Original CRISPR CAAGGTCACAAATCCAAAGT GGG (reversed) Intergenic
No off target data available for this crispr