ID: 1039263749

View in Genome Browser
Species Human (GRCh38)
Location 8:35802268-35802290
Sequence CTCCTTGCTGCTCCTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039263749_1039263755 28 Left 1039263749 8:35802268-35802290 CCTATTCAAGGAGCAGCAAGGAG No data
Right 1039263755 8:35802319-35802341 GTGAGTTCAGAGAAGTGAAGGGG No data
1039263749_1039263751 3 Left 1039263749 8:35802268-35802290 CCTATTCAAGGAGCAGCAAGGAG No data
Right 1039263751 8:35802294-35802316 AGTGTGAGCGAGAGAATAGTAGG No data
1039263749_1039263753 26 Left 1039263749 8:35802268-35802290 CCTATTCAAGGAGCAGCAAGGAG No data
Right 1039263753 8:35802317-35802339 AGGTGAGTTCAGAGAAGTGAAGG No data
1039263749_1039263754 27 Left 1039263749 8:35802268-35802290 CCTATTCAAGGAGCAGCAAGGAG No data
Right 1039263754 8:35802318-35802340 GGTGAGTTCAGAGAAGTGAAGGG No data
1039263749_1039263752 6 Left 1039263749 8:35802268-35802290 CCTATTCAAGGAGCAGCAAGGAG No data
Right 1039263752 8:35802297-35802319 GTGAGCGAGAGAATAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039263749 Original CRISPR CTCCTTGCTGCTCCTTGAAT AGG (reversed) Intergenic
No off target data available for this crispr