ID: 1039265836

View in Genome Browser
Species Human (GRCh38)
Location 8:35823011-35823033
Sequence CTGAGTGGACAGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039265836_1039265840 -3 Left 1039265836 8:35823011-35823033 CCCTCCTCAGTCTGTCCACTCAG No data
Right 1039265840 8:35823031-35823053 CAGACAAACCACAACCAAATAGG No data
1039265836_1039265845 18 Left 1039265836 8:35823011-35823033 CCCTCCTCAGTCTGTCCACTCAG No data
Right 1039265845 8:35823052-35823074 GGGCTGCAGGCACCAATGCCTGG No data
1039265836_1039265841 -2 Left 1039265836 8:35823011-35823033 CCCTCCTCAGTCTGTCCACTCAG No data
Right 1039265841 8:35823032-35823054 AGACAAACCACAACCAAATAGGG No data
1039265836_1039265843 5 Left 1039265836 8:35823011-35823033 CCCTCCTCAGTCTGTCCACTCAG No data
Right 1039265843 8:35823039-35823061 CCACAACCAAATAGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039265836 Original CRISPR CTGAGTGGACAGACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr