ID: 1039274064

View in Genome Browser
Species Human (GRCh38)
Location 8:35915522-35915544
Sequence TTCTTAAAGGCCATCATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039274058_1039274064 17 Left 1039274058 8:35915482-35915504 CCATTCACAAAGGAGAAGCCCTC No data
Right 1039274064 8:35915522-35915544 TTCTTAAAGGCCATCATTATTGG No data
1039274060_1039274064 -1 Left 1039274060 8:35915500-35915522 CCCTCATGAAAGGCCTAATCACT No data
Right 1039274064 8:35915522-35915544 TTCTTAAAGGCCATCATTATTGG No data
1039274056_1039274064 25 Left 1039274056 8:35915474-35915496 CCTTAATCCCATTCACAAAGGAG No data
Right 1039274064 8:35915522-35915544 TTCTTAAAGGCCATCATTATTGG No data
1039274057_1039274064 18 Left 1039274057 8:35915481-35915503 CCCATTCACAAAGGAGAAGCCCT No data
Right 1039274064 8:35915522-35915544 TTCTTAAAGGCCATCATTATTGG No data
1039274061_1039274064 -2 Left 1039274061 8:35915501-35915523 CCTCATGAAAGGCCTAATCACTT No data
Right 1039274064 8:35915522-35915544 TTCTTAAAGGCCATCATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039274064 Original CRISPR TTCTTAAAGGCCATCATTAT TGG Intergenic
No off target data available for this crispr