ID: 1039275244

View in Genome Browser
Species Human (GRCh38)
Location 8:35927678-35927700
Sequence ATGGAACCTACTGCATGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039275239_1039275244 10 Left 1039275239 8:35927645-35927667 CCAGTTCCACAAGTTCAGGGTTC No data
Right 1039275244 8:35927678-35927700 ATGGAACCTACTGCATGTGATGG No data
1039275240_1039275244 4 Left 1039275240 8:35927651-35927673 CCACAAGTTCAGGGTTCCTTTCT No data
Right 1039275244 8:35927678-35927700 ATGGAACCTACTGCATGTGATGG No data
1039275236_1039275244 25 Left 1039275236 8:35927630-35927652 CCATTACAAAAGATTCCAGTTCC No data
Right 1039275244 8:35927678-35927700 ATGGAACCTACTGCATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039275244 Original CRISPR ATGGAACCTACTGCATGTGA TGG Intergenic
No off target data available for this crispr