ID: 1039275989

View in Genome Browser
Species Human (GRCh38)
Location 8:35934527-35934549
Sequence GTCCCACTGGGTATCCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039275989_1039275992 -6 Left 1039275989 8:35934527-35934549 CCAGTATGGATACCCAGTGGGAC No data
Right 1039275992 8:35934544-35934566 TGGGACCTCAACTCAGATCATGG 0: 27
1: 53
2: 101
3: 54
4: 146
1039275989_1039275993 -5 Left 1039275989 8:35934527-35934549 CCAGTATGGATACCCAGTGGGAC No data
Right 1039275993 8:35934545-35934567 GGGACCTCAACTCAGATCATGGG 0: 25
1: 53
2: 106
3: 58
4: 104
1039275989_1039275996 1 Left 1039275989 8:35934527-35934549 CCAGTATGGATACCCAGTGGGAC No data
Right 1039275996 8:35934551-35934573 TCAACTCAGATCATGGGGACTGG 0: 31
1: 56
2: 102
3: 55
4: 134
1039275989_1039275994 -4 Left 1039275989 8:35934527-35934549 CCAGTATGGATACCCAGTGGGAC No data
Right 1039275994 8:35934546-35934568 GGACCTCAACTCAGATCATGGGG 0: 25
1: 57
2: 99
3: 63
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039275989 Original CRISPR GTCCCACTGGGTATCCATAC TGG (reversed) Intergenic
No off target data available for this crispr