ID: 1039278292

View in Genome Browser
Species Human (GRCh38)
Location 8:35955661-35955683
Sequence ATCTAGTTGTTTAGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039278292_1039278298 -5 Left 1039278292 8:35955661-35955683 CCTACTTCTCTAAACAACTAGAT No data
Right 1039278298 8:35955679-35955701 TAGATGGGGTTTCTAAGGGTTGG No data
1039278292_1039278301 17 Left 1039278292 8:35955661-35955683 CCTACTTCTCTAAACAACTAGAT No data
Right 1039278301 8:35955701-35955723 GCCCCCATGTTTGAGGGCCTTGG No data
1039278292_1039278296 -10 Left 1039278292 8:35955661-35955683 CCTACTTCTCTAAACAACTAGAT No data
Right 1039278296 8:35955674-35955696 ACAACTAGATGGGGTTTCTAAGG No data
1039278292_1039278300 11 Left 1039278292 8:35955661-35955683 CCTACTTCTCTAAACAACTAGAT No data
Right 1039278300 8:35955695-35955717 GGGTTGGCCCCCATGTTTGAGGG No data
1039278292_1039278299 10 Left 1039278292 8:35955661-35955683 CCTACTTCTCTAAACAACTAGAT No data
Right 1039278299 8:35955694-35955716 AGGGTTGGCCCCCATGTTTGAGG No data
1039278292_1039278297 -9 Left 1039278292 8:35955661-35955683 CCTACTTCTCTAAACAACTAGAT No data
Right 1039278297 8:35955675-35955697 CAACTAGATGGGGTTTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039278292 Original CRISPR ATCTAGTTGTTTAGAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr