ID: 1039278388

View in Genome Browser
Species Human (GRCh38)
Location 8:35956286-35956308
Sequence AAAGGCCTATTAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039278382_1039278388 5 Left 1039278382 8:35956258-35956280 CCAAGTGTATGGGGCATTATACA No data
Right 1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG No data
1039278378_1039278388 18 Left 1039278378 8:35956245-35956267 CCTTTTTAACTCTCCAAGTGTAT No data
Right 1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039278388 Original CRISPR AAAGGCCTATTAAACTCTGG GGG Intergenic
No off target data available for this crispr