ID: 1039279545

View in Genome Browser
Species Human (GRCh38)
Location 8:35968713-35968735
Sequence TCCTCAGCACACTCCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039279545_1039279548 29 Left 1039279545 8:35968713-35968735 CCTCTGTGGGAGTGTGCTGAGGA No data
Right 1039279548 8:35968765-35968787 TGGTATAAAACTTAGCTGTTTGG No data
1039279545_1039279549 30 Left 1039279545 8:35968713-35968735 CCTCTGTGGGAGTGTGCTGAGGA No data
Right 1039279549 8:35968766-35968788 GGTATAAAACTTAGCTGTTTGGG No data
1039279545_1039279547 9 Left 1039279545 8:35968713-35968735 CCTCTGTGGGAGTGTGCTGAGGA No data
Right 1039279547 8:35968745-35968767 TAGTTTAGTAACAAGACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039279545 Original CRISPR TCCTCAGCACACTCCCACAG AGG (reversed) Intergenic
No off target data available for this crispr