ID: 1039282892

View in Genome Browser
Species Human (GRCh38)
Location 8:36006258-36006280
Sequence GAGGGTGAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039282882_1039282892 23 Left 1039282882 8:36006212-36006234 CCCAGCTCATCTCGCTGGGACTG No data
Right 1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG No data
1039282883_1039282892 22 Left 1039282883 8:36006213-36006235 CCAGCTCATCTCGCTGGGACTGA No data
Right 1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039282892 Original CRISPR GAGGGTGAACAGAAGCAGGG TGG Intergenic
No off target data available for this crispr