ID: 1039287346

View in Genome Browser
Species Human (GRCh38)
Location 8:36056447-36056469
Sequence TCTTCTTTTGCCTAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039287346_1039287348 22 Left 1039287346 8:36056447-36056469 CCTGCTTGTTAGGCAAAAGAAGA No data
Right 1039287348 8:36056492-36056514 ATTTGGTACTTTATATACTGTGG No data
1039287346_1039287350 24 Left 1039287346 8:36056447-36056469 CCTGCTTGTTAGGCAAAAGAAGA No data
Right 1039287350 8:36056494-36056516 TTGGTACTTTATATACTGTGGGG No data
1039287346_1039287349 23 Left 1039287346 8:36056447-36056469 CCTGCTTGTTAGGCAAAAGAAGA No data
Right 1039287349 8:36056493-36056515 TTTGGTACTTTATATACTGTGGG No data
1039287346_1039287347 5 Left 1039287346 8:36056447-36056469 CCTGCTTGTTAGGCAAAAGAAGA No data
Right 1039287347 8:36056475-36056497 AAGTTGTTTTCATTTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039287346 Original CRISPR TCTTCTTTTGCCTAACAAGC AGG (reversed) Intergenic
No off target data available for this crispr