ID: 1039288943

View in Genome Browser
Species Human (GRCh38)
Location 8:36073159-36073181
Sequence TTCGGGATTGGTGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039288943_1039288946 -10 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288946 8:36073172-36073194 CAATCCCGAAGCACCTCGCTGGG No data
1039288943_1039288950 1 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288950 8:36073183-36073205 CACCTCGCTGGGCATCTGTTGGG No data
1039288943_1039288953 8 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288953 8:36073190-36073212 CTGGGCATCTGTTGGGTGGAAGG No data
1039288943_1039288952 4 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288952 8:36073186-36073208 CTCGCTGGGCATCTGTTGGGTGG No data
1039288943_1039288949 0 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288949 8:36073182-36073204 GCACCTCGCTGGGCATCTGTTGG No data
1039288943_1039288954 9 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039288943 Original CRISPR TTCGGGATTGGTGTTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr