ID: 1039288949

View in Genome Browser
Species Human (GRCh38)
Location 8:36073182-36073204
Sequence GCACCTCGCTGGGCATCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039288942_1039288949 7 Left 1039288942 8:36073152-36073174 CCAAGCACCAGGGGAAACACCAA No data
Right 1039288949 8:36073182-36073204 GCACCTCGCTGGGCATCTGTTGG No data
1039288943_1039288949 0 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288949 8:36073182-36073204 GCACCTCGCTGGGCATCTGTTGG No data
1039288941_1039288949 8 Left 1039288941 8:36073151-36073173 CCCAAGCACCAGGGGAAACACCA No data
Right 1039288949 8:36073182-36073204 GCACCTCGCTGGGCATCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039288949 Original CRISPR GCACCTCGCTGGGCATCTGT TGG Intergenic