ID: 1039288952

View in Genome Browser
Species Human (GRCh38)
Location 8:36073186-36073208
Sequence CTCGCTGGGCATCTGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039288942_1039288952 11 Left 1039288942 8:36073152-36073174 CCAAGCACCAGGGGAAACACCAA No data
Right 1039288952 8:36073186-36073208 CTCGCTGGGCATCTGTTGGGTGG No data
1039288944_1039288952 -8 Left 1039288944 8:36073171-36073193 CCAATCCCGAAGCACCTCGCTGG No data
Right 1039288952 8:36073186-36073208 CTCGCTGGGCATCTGTTGGGTGG No data
1039288941_1039288952 12 Left 1039288941 8:36073151-36073173 CCCAAGCACCAGGGGAAACACCA No data
Right 1039288952 8:36073186-36073208 CTCGCTGGGCATCTGTTGGGTGG No data
1039288943_1039288952 4 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288952 8:36073186-36073208 CTCGCTGGGCATCTGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039288952 Original CRISPR CTCGCTGGGCATCTGTTGGG TGG Intergenic