ID: 1039288954

View in Genome Browser
Species Human (GRCh38)
Location 8:36073191-36073213
Sequence TGGGCATCTGTTGGGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039288943_1039288954 9 Left 1039288943 8:36073159-36073181 CCAGGGGAAACACCAATCCCGAA No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data
1039288948_1039288954 -9 Left 1039288948 8:36073177-36073199 CCGAAGCACCTCGCTGGGCATCT No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data
1039288941_1039288954 17 Left 1039288941 8:36073151-36073173 CCCAAGCACCAGGGGAAACACCA No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data
1039288947_1039288954 -8 Left 1039288947 8:36073176-36073198 CCCGAAGCACCTCGCTGGGCATC No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data
1039288944_1039288954 -3 Left 1039288944 8:36073171-36073193 CCAATCCCGAAGCACCTCGCTGG No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data
1039288942_1039288954 16 Left 1039288942 8:36073152-36073174 CCAAGCACCAGGGGAAACACCAA No data
Right 1039288954 8:36073191-36073213 TGGGCATCTGTTGGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039288954 Original CRISPR TGGGCATCTGTTGGGTGGAA GGG Intergenic