ID: 1039289167

View in Genome Browser
Species Human (GRCh38)
Location 8:36075372-36075394
Sequence CTGGCTATCGGATGGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289167_1039289175 29 Left 1039289167 8:36075372-36075394 CCATCACTCCATCCGATAGCCAG No data
Right 1039289175 8:36075424-36075446 GACATACATTTTACTGCATTGGG No data
1039289167_1039289174 28 Left 1039289167 8:36075372-36075394 CCATCACTCCATCCGATAGCCAG No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289167 Original CRISPR CTGGCTATCGGATGGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr