ID: 1039289168

View in Genome Browser
Species Human (GRCh38)
Location 8:36075380-36075402
Sequence AGGGCTGTCTGGCTATCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289168_1039289175 21 Left 1039289168 8:36075380-36075402 CCATCCGATAGCCAGACAGCCCT No data
Right 1039289175 8:36075424-36075446 GACATACATTTTACTGCATTGGG No data
1039289168_1039289174 20 Left 1039289168 8:36075380-36075402 CCATCCGATAGCCAGACAGCCCT No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289168_1039289176 28 Left 1039289168 8:36075380-36075402 CCATCCGATAGCCAGACAGCCCT No data
Right 1039289176 8:36075431-36075453 ATTTTACTGCATTGGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289168 Original CRISPR AGGGCTGTCTGGCTATCGGA TGG (reversed) Intergenic
No off target data available for this crispr