ID: 1039289169

View in Genome Browser
Species Human (GRCh38)
Location 8:36075384-36075406
Sequence ATTAAGGGCTGTCTGGCTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289169_1039289174 16 Left 1039289169 8:36075384-36075406 CCGATAGCCAGACAGCCCTTAAT No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289169_1039289176 24 Left 1039289169 8:36075384-36075406 CCGATAGCCAGACAGCCCTTAAT No data
Right 1039289176 8:36075431-36075453 ATTTTACTGCATTGGGTGCCTGG No data
1039289169_1039289175 17 Left 1039289169 8:36075384-36075406 CCGATAGCCAGACAGCCCTTAAT No data
Right 1039289175 8:36075424-36075446 GACATACATTTTACTGCATTGGG No data
1039289169_1039289177 30 Left 1039289169 8:36075384-36075406 CCGATAGCCAGACAGCCCTTAAT No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289169 Original CRISPR ATTAAGGGCTGTCTGGCTAT CGG (reversed) Intergenic
No off target data available for this crispr