ID: 1039289171

View in Genome Browser
Species Human (GRCh38)
Location 8:36075399-36075421
Sequence CAAGGCAAGTCAGCAATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289171_1039289175 2 Left 1039289171 8:36075399-36075421 CCCTTAATTGCTGACTTGCCTTG No data
Right 1039289175 8:36075424-36075446 GACATACATTTTACTGCATTGGG No data
1039289171_1039289176 9 Left 1039289171 8:36075399-36075421 CCCTTAATTGCTGACTTGCCTTG No data
Right 1039289176 8:36075431-36075453 ATTTTACTGCATTGGGTGCCTGG No data
1039289171_1039289174 1 Left 1039289171 8:36075399-36075421 CCCTTAATTGCTGACTTGCCTTG No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289171_1039289177 15 Left 1039289171 8:36075399-36075421 CCCTTAATTGCTGACTTGCCTTG No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289171 Original CRISPR CAAGGCAAGTCAGCAATTAA GGG (reversed) Intergenic
No off target data available for this crispr