ID: 1039289173

View in Genome Browser
Species Human (GRCh38)
Location 8:36075417-36075439
Sequence CAGTAAAATGTATGTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289173_1039289176 -9 Left 1039289173 8:36075417-36075439 CCTTGCTGACATACATTTTACTG No data
Right 1039289176 8:36075431-36075453 ATTTTACTGCATTGGGTGCCTGG No data
1039289173_1039289177 -3 Left 1039289173 8:36075417-36075439 CCTTGCTGACATACATTTTACTG No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289173 Original CRISPR CAGTAAAATGTATGTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr