ID: 1039289174

View in Genome Browser
Species Human (GRCh38)
Location 8:36075423-36075445
Sequence TGACATACATTTTACTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289168_1039289174 20 Left 1039289168 8:36075380-36075402 CCATCCGATAGCCAGACAGCCCT No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289170_1039289174 9 Left 1039289170 8:36075391-36075413 CCAGACAGCCCTTAATTGCTGAC No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289171_1039289174 1 Left 1039289171 8:36075399-36075421 CCCTTAATTGCTGACTTGCCTTG No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289169_1039289174 16 Left 1039289169 8:36075384-36075406 CCGATAGCCAGACAGCCCTTAAT No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289172_1039289174 0 Left 1039289172 8:36075400-36075422 CCTTAATTGCTGACTTGCCTTGC No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data
1039289167_1039289174 28 Left 1039289167 8:36075372-36075394 CCATCACTCCATCCGATAGCCAG No data
Right 1039289174 8:36075423-36075445 TGACATACATTTTACTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289174 Original CRISPR TGACATACATTTTACTGCAT TGG Intergenic
No off target data available for this crispr