ID: 1039289177

View in Genome Browser
Species Human (GRCh38)
Location 8:36075437-36075459
Sequence CTGCATTGGGTGCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289169_1039289177 30 Left 1039289169 8:36075384-36075406 CCGATAGCCAGACAGCCCTTAAT No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data
1039289172_1039289177 14 Left 1039289172 8:36075400-36075422 CCTTAATTGCTGACTTGCCTTGC No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data
1039289171_1039289177 15 Left 1039289171 8:36075399-36075421 CCCTTAATTGCTGACTTGCCTTG No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data
1039289173_1039289177 -3 Left 1039289173 8:36075417-36075439 CCTTGCTGACATACATTTTACTG No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data
1039289170_1039289177 23 Left 1039289170 8:36075391-36075413 CCAGACAGCCCTTAATTGCTGAC No data
Right 1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289177 Original CRISPR CTGCATTGGGTGCCTGGCCA AGG Intergenic
No off target data available for this crispr