ID: 1039289404

View in Genome Browser
Species Human (GRCh38)
Location 8:36077615-36077637
Sequence GTGAACTCCTGCACGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039289392_1039289404 17 Left 1039289392 8:36077575-36077597 CCCCCCAGGCTCTCCTGAGCCAG No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289395_1039289404 14 Left 1039289395 8:36077578-36077600 CCCAGGCTCTCCTGAGCCAGCTG No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289400_1039289404 -9 Left 1039289400 8:36077601-36077623 CCTCTGCCACTGTGGTGAACTCC No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289396_1039289404 13 Left 1039289396 8:36077579-36077601 CCAGGCTCTCCTGAGCCAGCTGC No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289397_1039289404 4 Left 1039289397 8:36077588-36077610 CCTGAGCCAGCTGCCTCTGCCAC No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289391_1039289404 24 Left 1039289391 8:36077568-36077590 CCAAGGGCCCCCCAGGCTCTCCT No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289390_1039289404 27 Left 1039289390 8:36077565-36077587 CCACCAAGGGCCCCCCAGGCTCT No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289394_1039289404 15 Left 1039289394 8:36077577-36077599 CCCCAGGCTCTCCTGAGCCAGCT No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289393_1039289404 16 Left 1039289393 8:36077576-36077598 CCCCCAGGCTCTCCTGAGCCAGC No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data
1039289399_1039289404 -2 Left 1039289399 8:36077594-36077616 CCAGCTGCCTCTGCCACTGTGGT No data
Right 1039289404 8:36077615-36077637 GTGAACTCCTGCACGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039289404 Original CRISPR GTGAACTCCTGCACGGAGGC AGG Intergenic
No off target data available for this crispr