ID: 1039292313

View in Genome Browser
Species Human (GRCh38)
Location 8:36109912-36109934
Sequence AGTTATCTACAGAGGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039292311_1039292313 14 Left 1039292311 8:36109875-36109897 CCAGGTGTAGAATAAAGCTGTTT No data
Right 1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG No data
1039292310_1039292313 15 Left 1039292310 8:36109874-36109896 CCCAGGTGTAGAATAAAGCTGTT No data
Right 1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039292313 Original CRISPR AGTTATCTACAGAGGATAGC AGG Intergenic
No off target data available for this crispr