ID: 1039300719

View in Genome Browser
Species Human (GRCh38)
Location 8:36205830-36205852
Sequence CCTCCTGATCAGCGAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039300719_1039300723 0 Left 1039300719 8:36205830-36205852 CCCAGGCCTCGCTGATCAGGAGG No data
Right 1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039300719 Original CRISPR CCTCCTGATCAGCGAGGCCT GGG (reversed) Intergenic