ID: 1039300722

View in Genome Browser
Species Human (GRCh38)
Location 8:36205836-36205858
Sequence GAAGCACCTCCTGATCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039300722_1039300725 29 Left 1039300722 8:36205836-36205858 CCTCGCTGATCAGGAGGTGCTTC No data
Right 1039300725 8:36205888-36205910 TACTTCTGTACTCTTATCTCAGG No data
1039300722_1039300723 -6 Left 1039300722 8:36205836-36205858 CCTCGCTGATCAGGAGGTGCTTC No data
Right 1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039300722 Original CRISPR GAAGCACCTCCTGATCAGCG AGG (reversed) Intergenic