ID: 1039300722 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:36205836-36205858 |
Sequence | GAAGCACCTCCTGATCAGCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039300722_1039300725 | 29 | Left | 1039300722 | 8:36205836-36205858 | CCTCGCTGATCAGGAGGTGCTTC | No data | ||
Right | 1039300725 | 8:36205888-36205910 | TACTTCTGTACTCTTATCTCAGG | No data | ||||
1039300722_1039300723 | -6 | Left | 1039300722 | 8:36205836-36205858 | CCTCGCTGATCAGGAGGTGCTTC | No data | ||
Right | 1039300723 | 8:36205853-36205875 | TGCTTCTGTGCTTCCTGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039300722 | Original CRISPR | GAAGCACCTCCTGATCAGCG AGG (reversed) | Intergenic | ||