ID: 1039300723

View in Genome Browser
Species Human (GRCh38)
Location 8:36205853-36205875
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039300721_1039300723 -1 Left 1039300721 8:36205831-36205853 CCAGGCCTCGCTGATCAGGAGGT No data
Right 1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG No data
1039300717_1039300723 6 Left 1039300717 8:36205824-36205846 CCAGAGCCCAGGCCTCGCTGATC No data
Right 1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG No data
1039300719_1039300723 0 Left 1039300719 8:36205830-36205852 CCCAGGCCTCGCTGATCAGGAGG No data
Right 1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG No data
1039300722_1039300723 -6 Left 1039300722 8:36205836-36205858 CCTCGCTGATCAGGAGGTGCTTC No data
Right 1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039300723 Original CRISPR TGCTTCTGTGCTTCCTGCTT TGG Intergenic