ID: 1039309279

View in Genome Browser
Species Human (GRCh38)
Location 8:36298005-36298027
Sequence CTGTGAAAACAGCCGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039309272_1039309279 8 Left 1039309272 8:36297974-36297996 CCTGGAAAAGCCACTGACACTCA No data
Right 1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG No data
1039309271_1039309279 15 Left 1039309271 8:36297967-36297989 CCATGCACCTGGAAAAGCCACTG No data
Right 1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG No data
1039309273_1039309279 -2 Left 1039309273 8:36297984-36298006 CCACTGACACTCAATGCCAGCCT No data
Right 1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG No data
1039309269_1039309279 28 Left 1039309269 8:36297954-36297976 CCAACAGCTTGTACCATGCACCT No data
Right 1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039309279 Original CRISPR CTGTGAAAACAGCCGGAGTG GGG Intergenic
No off target data available for this crispr