ID: 1039311580

View in Genome Browser
Species Human (GRCh38)
Location 8:36322417-36322439
Sequence GGCCAGGGCGGCCACGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039311580_1039311594 25 Left 1039311580 8:36322417-36322439 CCTTCTCCGTGGCCGCCCTGGCC No data
Right 1039311594 8:36322465-36322487 AGGTTTCCAAGTAGAGGACGTGG No data
1039311580_1039311587 -4 Left 1039311580 8:36322417-36322439 CCTTCTCCGTGGCCGCCCTGGCC No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311580_1039311589 5 Left 1039311580 8:36322417-36322439 CCTTCTCCGTGGCCGCCCTGGCC No data
Right 1039311589 8:36322445-36322467 GGCCACCAGCCTGGCTGCGCAGG No data
1039311580_1039311593 19 Left 1039311580 8:36322417-36322439 CCTTCTCCGTGGCCGCCCTGGCC No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039311580 Original CRISPR GGCCAGGGCGGCCACGGAGA AGG (reversed) Intergenic
No off target data available for this crispr