ID: 1039311587

View in Genome Browser
Species Human (GRCh38)
Location 8:36322436-36322458
Sequence GGCCTTGAGGGCCACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039311571_1039311587 23 Left 1039311571 8:36322390-36322412 CCTCTGTGCCGCCTGGAGCCAGG No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311570_1039311587 29 Left 1039311570 8:36322384-36322406 CCAGTGCCTCTGTGCCGCCTGGA No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311576_1039311587 5 Left 1039311576 8:36322408-36322430 CCAGGCCCGCCTTCTCCGTGGCC No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311574_1039311587 12 Left 1039311574 8:36322401-36322423 CCTGGAGCCAGGCCCGCCTTCTC 0: 8
1: 6
2: 3
3: 33
4: 351
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311581_1039311587 -10 Left 1039311581 8:36322423-36322445 CCGTGGCCGCCCTGGCCTTGAGG No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311577_1039311587 0 Left 1039311577 8:36322413-36322435 CCCGCCTTCTCCGTGGCCGCCCT No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311578_1039311587 -1 Left 1039311578 8:36322414-36322436 CCGCCTTCTCCGTGGCCGCCCTG No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311580_1039311587 -4 Left 1039311580 8:36322417-36322439 CCTTCTCCGTGGCCGCCCTGGCC No data
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data
1039311573_1039311587 15 Left 1039311573 8:36322398-36322420 CCGCCTGGAGCCAGGCCCGCCTT 0: 6
1: 3
2: 2
3: 28
4: 252
Right 1039311587 8:36322436-36322458 GGCCTTGAGGGCCACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039311587 Original CRISPR GGCCTTGAGGGCCACCAGCC TGG Intergenic
No off target data available for this crispr