ID: 1039311593

View in Genome Browser
Species Human (GRCh38)
Location 8:36322459-36322481
Sequence CTGCGCAGGTTTCCAAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039311586_1039311593 3 Left 1039311586 8:36322433-36322455 CCTGGCCTTGAGGGCCACCAGCC No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311585_1039311593 4 Left 1039311585 8:36322432-36322454 CCCTGGCCTTGAGGGCCACCAGC No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311581_1039311593 13 Left 1039311581 8:36322423-36322445 CCGTGGCCGCCCTGGCCTTGAGG No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311584_1039311593 7 Left 1039311584 8:36322429-36322451 CCGCCCTGGCCTTGAGGGCCACC No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311580_1039311593 19 Left 1039311580 8:36322417-36322439 CCTTCTCCGTGGCCGCCCTGGCC No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311576_1039311593 28 Left 1039311576 8:36322408-36322430 CCAGGCCCGCCTTCTCCGTGGCC No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311577_1039311593 23 Left 1039311577 8:36322413-36322435 CCCGCCTTCTCCGTGGCCGCCCT No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311588_1039311593 -2 Left 1039311588 8:36322438-36322460 CCTTGAGGGCCACCAGCCTGGCT No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data
1039311578_1039311593 22 Left 1039311578 8:36322414-36322436 CCGCCTTCTCCGTGGCCGCCCTG No data
Right 1039311593 8:36322459-36322481 CTGCGCAGGTTTCCAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039311593 Original CRISPR CTGCGCAGGTTTCCAAGTAG AGG Intergenic
No off target data available for this crispr