ID: 1039324174

View in Genome Browser
Species Human (GRCh38)
Location 8:36466555-36466577
Sequence AGTTATCTACAGAAGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039324165_1039324174 25 Left 1039324165 8:36466507-36466529 CCACCAAAGCCCATCAACAGGCC No data
Right 1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG No data
1039324172_1039324174 4 Left 1039324172 8:36466528-36466550 CCAAGGGCTATCTCTCCAAAGGA No data
Right 1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG No data
1039324169_1039324174 16 Left 1039324169 8:36466516-36466538 CCCATCAACAGGCCAAGGGCTAT No data
Right 1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG No data
1039324170_1039324174 15 Left 1039324170 8:36466517-36466539 CCATCAACAGGCCAAGGGCTATC No data
Right 1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG No data
1039324166_1039324174 22 Left 1039324166 8:36466510-36466532 CCAAAGCCCATCAACAGGCCAAG No data
Right 1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039324174 Original CRISPR AGTTATCTACAGAAGATGTG AGG Intergenic
No off target data available for this crispr