ID: 1039331879

View in Genome Browser
Species Human (GRCh38)
Location 8:36546733-36546755
Sequence TCTCCTGAGAATGCGCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039331879_1039331885 29 Left 1039331879 8:36546733-36546755 CCTTATTGCGCATTCTCAGGAGA No data
Right 1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG No data
1039331879_1039331881 -2 Left 1039331879 8:36546733-36546755 CCTTATTGCGCATTCTCAGGAGA No data
Right 1039331881 8:36546754-36546776 GACTGGCCAGAACCTCTCTAAGG No data
1039331879_1039331886 30 Left 1039331879 8:36546733-36546755 CCTTATTGCGCATTCTCAGGAGA No data
Right 1039331886 8:36546786-36546808 AATTATCACCCAAAAAACGAGGG No data
1039331879_1039331883 5 Left 1039331879 8:36546733-36546755 CCTTATTGCGCATTCTCAGGAGA No data
Right 1039331883 8:36546761-36546783 CAGAACCTCTCTAAGGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039331879 Original CRISPR TCTCCTGAGAATGCGCAATA AGG (reversed) Intergenic
No off target data available for this crispr