ID: 1039331884

View in Genome Browser
Species Human (GRCh38)
Location 8:36546766-36546788
Sequence ATTGACCACTGACCTTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039331884_1039331891 15 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331891 8:36546804-36546826 GAGGGACAGCATCAGGTGGTTGG No data
1039331884_1039331886 -3 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331886 8:36546786-36546808 AATTATCACCCAAAAAACGAGGG No data
1039331884_1039331892 28 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331892 8:36546817-36546839 AGGTGGTTGGCTGACACTAGTGG No data
1039331884_1039331890 11 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331890 8:36546800-36546822 AAACGAGGGACAGCATCAGGTGG No data
1039331884_1039331885 -4 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG No data
1039331884_1039331889 8 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331889 8:36546797-36546819 AAAAAACGAGGGACAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039331884 Original CRISPR ATTGACCACTGACCTTAGAG AGG (reversed) Intergenic
No off target data available for this crispr