ID: 1039331885

View in Genome Browser
Species Human (GRCh38)
Location 8:36546785-36546807
Sequence CAATTATCACCCAAAAAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039331879_1039331885 29 Left 1039331879 8:36546733-36546755 CCTTATTGCGCATTCTCAGGAGA No data
Right 1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG No data
1039331884_1039331885 -4 Left 1039331884 8:36546766-36546788 CCTCTCTAAGGTCAGTGGTCAAT No data
Right 1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG No data
1039331882_1039331885 2 Left 1039331882 8:36546760-36546782 CCAGAACCTCTCTAAGGTCAGTG No data
Right 1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG No data
1039331878_1039331885 30 Left 1039331878 8:36546732-36546754 CCCTTATTGCGCATTCTCAGGAG No data
Right 1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039331885 Original CRISPR CAATTATCACCCAAAAAACG AGG Intergenic
No off target data available for this crispr