ID: 1039332062

View in Genome Browser
Species Human (GRCh38)
Location 8:36548509-36548531
Sequence AGAGCATCCCGTTGTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039332062_1039332065 21 Left 1039332062 8:36548509-36548531 CCAGGAGCACAACGGGATGCTCT No data
Right 1039332065 8:36548553-36548575 AGAACTCAGCCTGCTGCCCATGG No data
1039332062_1039332063 -4 Left 1039332062 8:36548509-36548531 CCAGGAGCACAACGGGATGCTCT No data
Right 1039332063 8:36548528-36548550 CTCTGTTGCCATGACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039332062 Original CRISPR AGAGCATCCCGTTGTGCTCC TGG (reversed) Intergenic
No off target data available for this crispr