ID: 1039339090

View in Genome Browser
Species Human (GRCh38)
Location 8:36627154-36627176
Sequence ACTTGAAGTCAGGAAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039339090_1039339097 10 Left 1039339090 8:36627154-36627176 CCAACTCCTTCCTGACTTCAAGT No data
Right 1039339097 8:36627187-36627209 CCTCAGCCTCCCAAAGTGCTAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1039339090_1039339099 18 Left 1039339090 8:36627154-36627176 CCAACTCCTTCCTGACTTCAAGT No data
Right 1039339099 8:36627195-36627217 TCCCAAAGTGCTAGGATTACAGG 0: 21761
1: 309030
2: 254826
3: 140031
4: 128248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039339090 Original CRISPR ACTTGAAGTCAGGAAGGAGT TGG (reversed) Intergenic
No off target data available for this crispr