ID: 1039341972

View in Genome Browser
Species Human (GRCh38)
Location 8:36660295-36660317
Sequence GGGCCATGCCAAATATGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039341968_1039341972 21 Left 1039341968 8:36660251-36660273 CCAAAAAGGAACACGTTGAAATG No data
Right 1039341972 8:36660295-36660317 GGGCCATGCCAAATATGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039341972 Original CRISPR GGGCCATGCCAAATATGCCA TGG Intergenic
No off target data available for this crispr