ID: 1039344060

View in Genome Browser
Species Human (GRCh38)
Location 8:36684517-36684539
Sequence TTGTTCCAATGTAAGATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039344055_1039344060 11 Left 1039344055 8:36684483-36684505 CCGGCTGTCCTGTGAATACACTT No data
Right 1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG No data
1039344057_1039344060 3 Left 1039344057 8:36684491-36684513 CCTGTGAATACACTTCACCTGGG No data
Right 1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039344060 Original CRISPR TTGTTCCAATGTAAGATCTC AGG Intergenic
No off target data available for this crispr