ID: 1039345896

View in Genome Browser
Species Human (GRCh38)
Location 8:36704878-36704900
Sequence CATGGCAACCAGCCCTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039345893_1039345896 6 Left 1039345893 8:36704849-36704871 CCTTTAAAAAACACTGGAAGAAG No data
Right 1039345896 8:36704878-36704900 CATGGCAACCAGCCCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039345896 Original CRISPR CATGGCAACCAGCCCTGCAA TGG Intergenic
No off target data available for this crispr