ID: 1039346812

View in Genome Browser
Species Human (GRCh38)
Location 8:36713702-36713724
Sequence TTCAAACACATGCCACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039346812_1039346817 8 Left 1039346812 8:36713702-36713724 CCTTGATGTGGCATGTGTTTGAA No data
Right 1039346817 8:36713733-36713755 CCAGTTCCACAGTTCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039346812 Original CRISPR TTCAAACACATGCCACATCA AGG (reversed) Intergenic
No off target data available for this crispr