ID: 1039346817

View in Genome Browser
Species Human (GRCh38)
Location 8:36713733-36713755
Sequence CCAGTTCCACAGTTCTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039346810_1039346817 24 Left 1039346810 8:36713686-36713708 CCATAGAGATCACTGGCCTTGAT No data
Right 1039346817 8:36713733-36713755 CCAGTTCCACAGTTCTCTGTTGG No data
1039346812_1039346817 8 Left 1039346812 8:36713702-36713724 CCTTGATGTGGCATGTGTTTGAA No data
Right 1039346817 8:36713733-36713755 CCAGTTCCACAGTTCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039346817 Original CRISPR CCAGTTCCACAGTTCTCTGT TGG Intergenic
No off target data available for this crispr