ID: 1039348213 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:36731692-36731714 |
| Sequence | GGGTGCAAACACATGGACAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039348208_1039348213 | 6 | Left | 1039348208 | 8:36731663-36731685 | CCAAACACTGCATGTTCTCACTC | 0: 4435 1: 11380 2: 17706 3: 10546 4: 8009 |
||
| Right | 1039348213 | 8:36731692-36731714 | GGGTGCAAACACATGGACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039348213 | Original CRISPR | GGGTGCAAACACATGGACAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||