ID: 1039348213

View in Genome Browser
Species Human (GRCh38)
Location 8:36731692-36731714
Sequence GGGTGCAAACACATGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039348208_1039348213 6 Left 1039348208 8:36731663-36731685 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039348213 Original CRISPR GGGTGCAAACACATGGACAC AGG Intergenic
No off target data available for this crispr