ID: 1039361935

View in Genome Browser
Species Human (GRCh38)
Location 8:36885923-36885945
Sequence CTGTATCACCTGAAGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039361926_1039361935 25 Left 1039361926 8:36885875-36885897 CCAGGGCTTTGCCTCAGCTGAGG 0: 1
1: 0
2: 4
3: 35
4: 275
Right 1039361935 8:36885923-36885945 CTGTATCACCTGAAGAAGAAAGG No data
1039361930_1039361935 14 Left 1039361930 8:36885886-36885908 CCTCAGCTGAGGGAATGGCATGT 0: 1
1: 0
2: 2
3: 25
4: 199
Right 1039361935 8:36885923-36885945 CTGTATCACCTGAAGAAGAAAGG No data
1039361925_1039361935 26 Left 1039361925 8:36885874-36885896 CCCAGGGCTTTGCCTCAGCTGAG 0: 1
1: 0
2: 1
3: 28
4: 252
Right 1039361935 8:36885923-36885945 CTGTATCACCTGAAGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039361935 Original CRISPR CTGTATCACCTGAAGAAGAA AGG Intronic
No off target data available for this crispr