ID: 1039362915

View in Genome Browser
Species Human (GRCh38)
Location 8:36899721-36899743
Sequence AGAGTTCTGCTGATGTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039362915_1039362918 23 Left 1039362915 8:36899721-36899743 CCATTAAACATCAGCAGAACTCT 0: 1
1: 0
2: 0
3: 20
4: 323
Right 1039362918 8:36899767-36899789 AGTTTTCTGCACAACATGGAAGG No data
1039362915_1039362917 19 Left 1039362915 8:36899721-36899743 CCATTAAACATCAGCAGAACTCT 0: 1
1: 0
2: 0
3: 20
4: 323
Right 1039362917 8:36899763-36899785 AGAAAGTTTTCTGCACAACATGG No data
1039362915_1039362916 -7 Left 1039362915 8:36899721-36899743 CCATTAAACATCAGCAGAACTCT 0: 1
1: 0
2: 0
3: 20
4: 323
Right 1039362916 8:36899737-36899759 GAACTCTTCAATAAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039362915 Original CRISPR AGAGTTCTGCTGATGTTTAA TGG (reversed) Intronic
902134006 1:14289172-14289194 AGAGTTCTGTAGATGTCTATTGG + Intergenic
902238920 1:15075336-15075358 AGGGTTGTGCTGATCTATAAGGG - Intronic
902926556 1:19699892-19699914 AGAGTTGTGATGATGCTTGAAGG - Intronic
903083655 1:20834900-20834922 TGTATTCTGCTGCTGTTTAATGG - Intronic
903351230 1:22717699-22717721 AGGGTGCTGCTGACATTTAATGG - Intronic
904419236 1:30380752-30380774 AGAGTTCTGTTGCTGTTATATGG - Intergenic
907792616 1:57682218-57682240 AAAGTGCTTCTTATGTTTAATGG - Intronic
908514876 1:64882314-64882336 AGAGTTGTTCTGAGGGTTAAAGG + Intronic
908646487 1:66283826-66283848 AGAGTACTGCTTACTTTTAATGG + Intronic
908939807 1:69418125-69418147 AGAGTTCTGTAGATGTCTATTGG - Intergenic
909167485 1:72247484-72247506 AGAGATCTGTGGATGTTTGAAGG - Intronic
910281981 1:85511000-85511022 AGAGTTCTGTAGATGTCTATTGG - Intronic
910405215 1:86881892-86881914 AGAATTCTGATGATCTCTAAGGG + Intronic
911130036 1:94378006-94378028 AGAGTTCTGCTCATGGCTACAGG + Intergenic
911159656 1:94671893-94671915 AGAGTCCCACAGATGTTTAATGG + Intergenic
911469394 1:98298384-98298406 AGAATTCTGCTGAGGTTTAGAGG + Intergenic
912284295 1:108352229-108352251 AGAGTTCTGTAGATGTCTATTGG + Intergenic
912561122 1:110552230-110552252 AGAGTGTTTCTGATGTATAATGG - Intergenic
913374661 1:118137456-118137478 AGAGTTCTGCAGATTTCAAATGG + Intronic
913493275 1:119402820-119402842 AGAGTTCTGTAGATGTCTATTGG + Intergenic
915684427 1:157617190-157617212 AGAGTCCTGAGAATGTTTAAGGG + Intergenic
916030213 1:160870281-160870303 AGAGTTCTGCAGATGGATGATGG - Intergenic
916083361 1:161250946-161250968 AGAGTTCTGCTCATGGCTACAGG - Intergenic
916114203 1:161473554-161473576 AGAGTTCTGCTCATGTCCACAGG - Intergenic
916494695 1:165335904-165335926 AAAGTAATGCTGAGGTTTAAAGG + Intronic
916898031 1:169187236-169187258 AGAGTTCTGTAGATGTCTATTGG + Intronic
917060313 1:171030777-171030799 AGAGTTCTGCATATGTCTATTGG + Intronic
917266884 1:173230083-173230105 AGAGTTCTGTAGATGTCTATTGG - Intergenic
917676018 1:177320434-177320456 AGAGTTCTGCTCATGGCTACAGG - Intergenic
917998264 1:180464127-180464149 AGAGTTGTGCTGATTTTCAAGGG - Intronic
918803460 1:189004940-189004962 ATAGTTAAGCAGATGTTTAAAGG + Intergenic
918955485 1:191201366-191201388 AGAGTTCTGTAGATGTCTATTGG - Intergenic
919623050 1:199884440-199884462 AGAGTTCTGTAGATGTCTATTGG + Intergenic
921462273 1:215443590-215443612 AGAGGTCTGCTGTTGTCTGATGG + Intergenic
922147298 1:222960125-222960147 AGAGTTCTGTAGATGTCTATAGG - Intronic
923066694 1:230524756-230524778 AGAGTTCTGTAGATGTCTATTGG + Intergenic
923384407 1:233452343-233452365 AGAGTTAAGCTATTGTTTAAAGG - Intergenic
924444949 1:244120460-244120482 AGGGTACTGCTGACATTTAATGG - Intergenic
1063630097 10:7725315-7725337 AGAGTTGTGCAGATATCTAAGGG + Intronic
1063859326 10:10290829-10290851 AGAGTTCTGCTCATGGCTACAGG + Intergenic
1065066810 10:21976642-21976664 AGACTTCTGTTGATTTTTGATGG - Intronic
1065227882 10:23564483-23564505 AGCATTCTGCTGCTGTTTGATGG + Intergenic
1066014312 10:31223244-31223266 GGAGGTATGCTGATCTTTAATGG - Intergenic
1066751501 10:38661831-38661853 AGAGTTCTGTGGATGTCTATTGG - Intergenic
1067050328 10:43012790-43012812 AGAGTTAAGCTGTTGTCTAAAGG - Intergenic
1067820883 10:49529108-49529130 TGAGTTCTGGTGATGTGGAAGGG - Intronic
1068641358 10:59411822-59411844 AGAGTTCTGTGGATGTCTATTGG + Intergenic
1069254958 10:66321361-66321383 AGGGGGCTGCTGATATTTAAAGG + Intronic
1072225335 10:93363670-93363692 AGGGTTCTGTTGTTGTTTGAGGG - Intronic
1073453203 10:103621666-103621688 AGGGGACTGCAGATGTTTAAGGG + Intronic
1074586340 10:114770648-114770670 TGCTTTCTGCTGCTGTTTAATGG + Intergenic
1076322362 10:129592967-129592989 AGAGTCCTCATGATGCTTAAGGG + Intronic
1078967079 11:16358224-16358246 AGTAATGTGCTGATGTTTAATGG - Intronic
1079337601 11:19584870-19584892 AGAGTTCTGTAGATGTCTATTGG + Intronic
1080602149 11:33830386-33830408 AGAATTCTGGTGATGTTGCAGGG + Intergenic
1082147309 11:48685649-48685671 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1086608696 11:88727537-88727559 AGAGTTCTGTAGATGTCTATTGG - Intronic
1087069822 11:94067184-94067206 AGAGTGCTGCTCATATTTACAGG - Intronic
1087653785 11:100899333-100899355 AGAGTTCTGGAGATGTCTATTGG + Intronic
1088569190 11:111204837-111204859 AGAGTTTTGCTGAAGATTTAAGG - Intergenic
1089226516 11:116927637-116927659 AGAGTTCTGGTGTTTTTCAAGGG + Intronic
1090536835 11:127651931-127651953 AGAAACTTGCTGATGTTTAATGG - Intergenic
1091149356 11:133312879-133312901 AGATTTATACTGATGATTAAAGG + Intronic
1091549876 12:1529641-1529663 ATAATTCTCCTGATGTTTTATGG - Intergenic
1091849459 12:3683506-3683528 AGAGTGAGGCTGGTGTTTAAAGG - Intronic
1092603824 12:10097618-10097640 TAAGTTCTGCTGAGGTTGAAGGG - Intronic
1092682558 12:11001549-11001571 AGAGTTGTGCTGAAGTTTTGAGG - Intronic
1093844227 12:23949348-23949370 AGATTTCTGCTAATGTTTTTAGG - Intronic
1094069299 12:26395326-26395348 ACAGTTATTGTGATGTTTAAAGG + Intronic
1097836629 12:64279829-64279851 AGTGTTCTGTTGATTTTAAAAGG - Intronic
1098015291 12:66098226-66098248 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1098826102 12:75298843-75298865 AGAGTTCTAACAATGTTTAATGG + Intronic
1099086720 12:78255511-78255533 AGAGTTCTGTAGATGTTTATTGG + Intergenic
1099235454 12:80078168-80078190 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1099239887 12:80126531-80126553 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1099376043 12:81897282-81897304 AGAGTTCTGCTTATGGCTACAGG - Intergenic
1099403232 12:82225911-82225933 AGACTTTTGCTCATGTTTCAAGG - Intronic
1099891287 12:88591981-88592003 AGTGGTCTGATGATGTTGAAAGG - Intergenic
1101042109 12:100766698-100766720 AGAATTCTGCTGCTGTTGGATGG + Intronic
1102507835 12:113395027-113395049 AGAATTCTGCTGTTGTTAATTGG + Intronic
1103078618 12:118005552-118005574 ACAGATCTGCTGATCTTCAAGGG + Intergenic
1103101858 12:118183337-118183359 AAAGTTTGGCTAATGTTTAATGG - Intronic
1103214935 12:119194665-119194687 TGAGTTATGCTGTTGTTTAGGGG + Exonic
1104550926 12:129756581-129756603 AGAGTTCTGGAGATGGATAAGGG + Intronic
1107458879 13:40581398-40581420 AAAGTTCTGTTGATGATAAAAGG - Intronic
1108387171 13:49910088-49910110 AGAGTTCTACAGAAATTTAAAGG - Intergenic
1109257341 13:60099282-60099304 AGTGTTCTGAGGATGTTTAAGGG - Intronic
1109746303 13:66627544-66627566 GCAGTTCTCTTGATGTTTAATGG - Intronic
1109781180 13:67112382-67112404 AGAGTTCTGCTGCTGATCATAGG - Intronic
1110656045 13:78000995-78001017 AGAGTTCTGTAGATGTCTATCGG - Intergenic
1113055643 13:106264082-106264104 AGAGTCCTTATGATTTTTAATGG - Intergenic
1113384661 13:109837465-109837487 TGAGTGCAGCTGATGTTCAATGG - Intergenic
1115855997 14:37630571-37630593 AGAGTTCTGTAGATGTCTATTGG + Intronic
1116302307 14:43199341-43199363 GGAGTTTACCTGATGTTTAAAGG - Intergenic
1116871985 14:50076487-50076509 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1116908368 14:50429843-50429865 ATCGTTTTGCTGATATTTAAAGG + Intronic
1116914311 14:50507839-50507861 AGAGTTCTGTAGATGTCTATTGG + Intronic
1119076859 14:71648828-71648850 TGAGTTCTGGTGATAGTTAATGG + Intronic
1124715782 15:32060164-32060186 AGATTGCTGTTGATGTTTCATGG - Intronic
1124882942 15:33659100-33659122 AGAGTGCTGCTGATGTGCAGTGG + Intronic
1126064225 15:44812918-44812940 AGAGTTCTGATGCTGTAGAAGGG + Intergenic
1130821421 15:87500275-87500297 GGAGGTCTGCTGGTGATTAAAGG - Intergenic
1130879472 15:88042746-88042768 AGGGTTGTGGTGATGATTAAGGG - Intronic
1131192455 15:90327497-90327519 AGAGTTCTGCAGATGTGTGGTGG + Intergenic
1131410951 15:92208014-92208036 AGAGTTCTGCTGATGGCTACAGG - Intergenic
1131713286 15:95079638-95079660 ACATTTCCCCTGATGTTTAAAGG + Intergenic
1132135729 15:99336794-99336816 GGAGTTCTGCTGAAGTTGCAGGG - Intronic
1132188906 15:99831444-99831466 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1132442603 15:101883715-101883737 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1135431432 16:22387023-22387045 ATAGTTCTGCTGAGGCTTAAAGG - Intronic
1136731219 16:32415276-32415298 AGAGTTCTGTGGATGTCTATTGG + Intergenic
1137623804 16:49894799-49894821 AAAGTTCTGCAGATGTGTAGAGG + Intergenic
1137821624 16:51451133-51451155 GGGGTTCTTCTGATGTTTACAGG - Intergenic
1138260622 16:55618081-55618103 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1141962790 16:87420755-87420777 AGAATTCTGCTGGTGTTGGATGG - Intronic
1202995172 16_KI270728v1_random:101997-102019 AGAGTTCTGTGGATGTCTATTGG - Intergenic
1203021859 16_KI270728v1_random:414339-414361 AGAGTTCTGTGGATGTCTATTGG - Intergenic
1146449236 17:32959297-32959319 AGGGTTTGGCTGATGTGTAACGG + Intergenic
1147058580 17:37854749-37854771 ATAGTTTTGCTGATATTTAGAGG - Intergenic
1147540283 17:41351576-41351598 AGAGTTCTGGTGAGGAATAATGG - Intergenic
1149892612 17:60403392-60403414 AAAGTTCTGCCCAGGTTTAAGGG + Intronic
1150364535 17:64569645-64569667 GCTGTTCTGATGATGTTTAATGG - Intronic
1150706087 17:67488670-67488692 AGAGTTCTGCAGATGGATAGTGG - Intronic
1150928675 17:69561091-69561113 ACAGTTCTGCAGCTGTTGAAAGG - Intergenic
1151127773 17:71863583-71863605 TGAGTTCTGGTAATGTTTAGAGG + Intergenic
1153745458 18:8174176-8174198 AGAATTCTGCTAAAGTGTAAAGG - Intronic
1154936766 18:21067183-21067205 ACAGTTCTGCACATGTTTACTGG + Intronic
1154996905 18:21649142-21649164 GGAGTGCGGCAGATGTTTAAAGG + Intergenic
1155875683 18:31084455-31084477 AGAGAAATTCTGATGTTTAAAGG + Intronic
1155945884 18:31850866-31850888 AGAGTCCTGCTGATGTTTCTGGG + Intronic
1157016062 18:43714977-43714999 AGATTTTTGGTGATGATTAAAGG + Intergenic
1157091880 18:44645976-44645998 AAAGTGCTGCTCATGATTAAGGG - Intergenic
1160295466 18:77633143-77633165 AGAGCTCTGCAGATATTGAATGG - Intergenic
1163154634 19:15433043-15433065 AGAGTTTTGACGTTGTTTAAGGG - Intronic
1164085396 19:21897449-21897471 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1164332696 19:24275210-24275232 AGCTTTCTTCTGATTTTTAATGG + Intergenic
1166342875 19:42149347-42149369 CGTGTTCTGCTGATGTTCCAAGG + Intronic
1166552468 19:43675513-43675535 AAGGTTCTGCTGACGTGTAAAGG + Intergenic
925192680 2:1898450-1898472 AGAGTTGAGCTGATGTCCAAAGG + Intronic
925765983 2:7235788-7235810 GGAGTTCTGCTTATTGTTAATGG + Intergenic
926133301 2:10319029-10319051 AGAGTTCAGAAGAGGTTTAATGG - Intronic
926444461 2:12926359-12926381 AGAGATCTGCTCATTTTAAAAGG - Intergenic
930563601 2:52991805-52991827 AGACTTCTGCTTATGGTTCATGG + Intergenic
933275372 2:80278367-80278389 AGAGTTCTGCTGATCTTGGGTGG + Intronic
934314488 2:91903983-91904005 AGAGTTCTGTGGATGTCTATTGG - Intergenic
934874214 2:97900048-97900070 AGTGTTCTGAGCATGTTTAAGGG - Intronic
935102570 2:100010906-100010928 AGAATTCTCCTGTTGATTAAAGG - Intronic
936019338 2:108982975-108982997 AGAGTTCTGCTGAATGTAAATGG + Intronic
937441835 2:121922100-121922122 GGAGTTATGCTGATGGATAAAGG - Intergenic
939671789 2:145021981-145022003 AGAGTTTTTCGTATGTTTAAAGG - Intergenic
939752990 2:146071954-146071976 TTAGTTCTGCTGCTGTATAAGGG - Intergenic
940019885 2:149145653-149145675 AAAATTTTGCTGATGTTAAAAGG - Intronic
940231348 2:151456696-151456718 ATAATTCTGCTGATTTTTAAAGG + Intronic
940379540 2:152998359-152998381 AGAGTTCTGTAGATGTCTATTGG - Intergenic
940417223 2:153437317-153437339 AGAGTTCTGTAGATGTCTATTGG + Intergenic
941508975 2:166382400-166382422 AGAGTTCTGAAGATTTTAAAGGG + Intergenic
941559794 2:167030701-167030723 AGAGTTCTGCAGATGTCTATTGG + Intronic
942700558 2:178704156-178704178 TGAGTTCTGCTGAAGTTTCAAGG + Exonic
943024987 2:182616881-182616903 AGACTTCCACTGAGGTTTAATGG - Intergenic
944033975 2:195270142-195270164 AGAGTTTTGCTGGTATTAAATGG - Intergenic
944392612 2:199232733-199232755 AGAGTTCTGTAGATATTTATCGG + Intergenic
945155937 2:206837636-206837658 ATAGTTATGGTGATGTATAATGG + Intergenic
948484760 2:238273385-238273407 AAAGTCCTTCTGATGTTTCAGGG - Intronic
948561008 2:238851887-238851909 AAAGGACTGCTGATATTTAAGGG - Intronic
1169306848 20:4499295-4499317 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1170020424 20:11831193-11831215 TGAGTGCTGCTGAAGTTTCATGG + Intergenic
1171516893 20:25745500-25745522 AGAGTCCTGATGAGGTTCAAGGG + Intergenic
1174561206 20:51432089-51432111 CAAGTTCTGCTCCTGTTTAATGG + Exonic
1174968379 20:55245606-55245628 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1176448078 21:6839676-6839698 ATCGTTCTGCGGATGTTAAAAGG + Intergenic
1176826248 21:13704698-13704720 ATCGTTCTGCGGATGTTAAAAGG + Intergenic
1177129918 21:17243119-17243141 AGAGTTCTGTAGATGTCTATCGG - Intergenic
1177134448 21:17294018-17294040 AGAGTTCTGTAGATGTCTATAGG - Intergenic
1178674767 21:34621709-34621731 AGAGGTTTACTGAGGTTTAATGG - Intergenic
1178775030 21:35541782-35541804 ATAATGCTGCTAATGTTTAATGG - Intronic
1180541258 22:16449864-16449886 AGAGTTCTGTGGATGTCTATTGG - Intergenic
1182058006 22:27375673-27375695 AGAGTTCTGTAGATGTTTATTGG - Intergenic
1182218084 22:28736087-28736109 AGTGTTCTGAGCATGTTTAAAGG + Intronic
1183726165 22:39590781-39590803 AGAACTCTGCTGATGTTGCAGGG + Intronic
949199092 3:1350722-1350744 ATAGGTCTGCTGATATCTAAAGG - Intronic
949352554 3:3139405-3139427 AGACTTCTGGTGATCGTTAACGG + Intronic
949450271 3:4177189-4177211 AGAGTTCTGTAGATGTCTATTGG - Intronic
949600603 3:5594291-5594313 AGAGTTCTGTAGATGTCTATTGG + Intergenic
950954189 3:17033829-17033851 ACAGTTCTGCATATGTTAAATGG - Intronic
951336024 3:21422911-21422933 TGTGTTGTGCTGATTTTTAAGGG - Intronic
951342925 3:21510940-21510962 AGATTTCTGCTTATTTTTCATGG + Exonic
951346964 3:21558642-21558664 AGAGTTCTGTAGATGTCTATTGG + Intronic
951829266 3:26906147-26906169 AGATTTCATCTGATGTTTGAAGG + Intergenic
952017837 3:28979912-28979934 AGAGTTCGGCTGAAGTATCATGG + Intergenic
952523200 3:34183310-34183332 AGAGTTCTGATGCTGTAGAAGGG - Intergenic
952729590 3:36624989-36625011 AGAGTTCTGTAGATGTCTATAGG + Intergenic
952794072 3:37223495-37223517 AGACTTCAGCTAATGATTAATGG + Intergenic
953337061 3:42102446-42102468 AGAGATTTGCTGATGTGTTAAGG + Intronic
953705487 3:45226771-45226793 AGAGTTTGGCTGCTTTTTAATGG + Intergenic
956161576 3:66359548-66359570 AGATTTCTGTTGATGACTAAAGG - Intronic
956606323 3:71076446-71076468 AGAGTTATGCTGAAGATGAAAGG + Intronic
956730191 3:72189417-72189439 AGAGATTTACTGATGCTTAAGGG + Intergenic
957010997 3:75006369-75006391 AGAGTTCTGCAGATGTCTATTGG + Intergenic
958078877 3:88719597-88719619 AGAGTTCTGCAGATGGATGATGG + Intergenic
958167818 3:89900024-89900046 AGAGTTCTGTAGATGTCTATTGG + Intergenic
958523660 3:95224668-95224690 AGAGTTCTGCAGATATCTATTGG + Intergenic
958703428 3:97622149-97622171 AGAGTTCTGCAGATGGATACTGG - Intronic
959781423 3:110238810-110238832 AAACTTCTGCTTATGTTTACTGG + Intergenic
960007937 3:112800218-112800240 AGAGTTCTGATAAGATTTAAGGG + Intronic
960839985 3:121947772-121947794 AGAGCTCTACTGAGGTTTAGAGG - Intergenic
961054038 3:123771752-123771774 AGTGTTCTGAGCATGTTTAAGGG - Intronic
961485918 3:127216433-127216455 AGAGTGCTGCTGCCTTTTAATGG - Intergenic
961538088 3:127582148-127582170 AGAGGTGTTCTGGTGTTTAAGGG - Intronic
962631217 3:137278020-137278042 AGCATTCTACTGATGTTTGAAGG + Intergenic
964783001 3:160361526-160361548 AGAGTTCTGTAGATGTCTATTGG - Intronic
964972000 3:162575341-162575363 AGAGTTCTGCTGATGGCCACAGG - Intergenic
965176119 3:165335715-165335737 AGAGGTCTGATGATACTTAAAGG + Intergenic
966750306 3:183315705-183315727 AGAGTTCTGCAGAGGTAAAAAGG - Intronic
967242258 3:187451555-187451577 GGAATTCTGCTGGAGTTTAATGG - Intergenic
967570662 3:191024819-191024841 AGAATTCTCGTGGTGTTTAACGG + Intergenic
969146325 4:5127170-5127192 AGATGTTTGCTTATGTTTAACGG - Intronic
971681611 4:29707661-29707683 AGAGATCTGATGGTTTTTAAAGG - Intergenic
971975242 4:33676611-33676633 TGTGTTCTTCTGCTGTTTAATGG + Intergenic
972042880 4:34625739-34625761 AGAGTTCTGTAGATGTCTATTGG + Intergenic
972212601 4:36856880-36856902 AGAGTTCTGTAGATGTCTATCGG - Intergenic
973827084 4:54719041-54719063 CGAGGTTTGCTGGTGTTTAAAGG - Intronic
974346280 4:60685798-60685820 AGAGTTCTGAGTATATTTAAGGG - Intergenic
975200898 4:71587859-71587881 AGTGTTCTGCTGCTGTTTAGTGG + Intergenic
976682417 4:87771717-87771739 AGAGTTCTGCAGATGTCTATTGG - Intergenic
976855277 4:89597338-89597360 AGAATTCTGCTGCAATTTAATGG + Intergenic
977453343 4:97226285-97226307 AGAGTTATGGAGATGGTTAATGG - Intronic
978216915 4:106215866-106215888 AGAGTTCTGTAGATGTCTATTGG - Intronic
978699501 4:111625926-111625948 AGAGTTCTGTAGATGTCTATTGG + Intergenic
979270784 4:118758968-118758990 AGACTTGTGCTGATTTATAATGG + Intronic
979293001 4:118998951-118998973 CCAGCTCTGCTGACGTTTAAAGG - Intronic
980223050 4:129945441-129945463 AGAGTTCTGTGGATGTCTATTGG + Intergenic
980669589 4:135987217-135987239 AGATTCCTGCTGCTCTTTAAAGG - Intergenic
980787130 4:137570555-137570577 AGAGTTCTGTAGATGTCTATTGG + Intergenic
981741387 4:148006021-148006043 CGAGTTCTACTCAGGTTTAAGGG - Intronic
982049260 4:151484122-151484144 AGAGCTCCTCTGATGTTTTAGGG + Intronic
982993976 4:162317424-162317446 AGAGTTCTGCTGGTGTCTTGAGG - Intergenic
983127452 4:163971769-163971791 GGAGAGCTGCTAATGTTTAAAGG + Intronic
983928777 4:173431177-173431199 AGAGTTCTGCTGATGGGCAAAGG + Intergenic
985004304 4:185518232-185518254 AGAACTCTGCTGATGTTAAGAGG + Intronic
986601392 5:9476769-9476791 ACAGTTCTGCTGTTTTCTAATGG - Intronic
986781952 5:11074819-11074841 AGATTCCTGGTGATATTTAAAGG - Intronic
986833648 5:11609956-11609978 AAATTTCTCCTCATGTTTAAAGG - Intronic
987117849 5:14740350-14740372 AGTGTTTTGCTAATGTTTTAGGG + Intronic
987959600 5:24788733-24788755 AGAGTTCTCATGACCTTTAAAGG + Intergenic
988334471 5:29888029-29888051 AAAGTTCTGCTTATGTGTGAAGG - Intergenic
990075014 5:51833286-51833308 AGAGTTCTGCTCATGATGACAGG - Intergenic
990884187 5:60573451-60573473 AGAGTTCTGTAGATGTCTATTGG + Intergenic
991689817 5:69215156-69215178 AGTGTTCTGCTGTTGTTTGGTGG - Intergenic
992281178 5:75178384-75178406 AGAGTTCTGTAGATGTCTATTGG - Intronic
992404108 5:76440197-76440219 AGATTTCTGCTGAAGTTAAGGGG + Intronic
992545506 5:77810823-77810845 AGAGTTCTGCTCATGACTACAGG - Intronic
994277927 5:97861691-97861713 ATAGTTGTGCTCATATTTAATGG - Intergenic
995178915 5:109211963-109211985 AGAGTTCTGTAGATGTCTATTGG + Intergenic
996466565 5:123809252-123809274 AGATTTCTGCTGAAATTAAAAGG - Intergenic
996512484 5:124332432-124332454 AGAGTTATGCTTTAGTTTAAAGG + Intergenic
997869345 5:137493432-137493454 ACAGTTCTGCTGAAGTATCATGG + Intronic
999147339 5:149405248-149405270 AGAATTCTGTTGGTGTTGAAAGG - Intergenic
999511974 5:152261504-152261526 AGAGGTATGGTGATGCTTAAAGG + Intergenic
1000499778 5:162034418-162034440 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1003887961 6:10537799-10537821 AGTGTTCTGAGCATGTTTAAGGG - Intronic
1004659025 6:17693550-17693572 AGAGATATGCTGGTGGTTAATGG - Intronic
1006039551 6:31242831-31242853 TCAGATCTGCTCATGTTTAAGGG - Intergenic
1006728605 6:36218214-36218236 AGAGTAGTGCTGATGCTTACAGG + Intronic
1007890896 6:45290557-45290579 GGATTTTTGTTGATGTTTAAAGG - Intronic
1008387426 6:50908228-50908250 AAGGTTCTGCTGATTTTCAATGG - Intergenic
1009810953 6:68665539-68665561 AGAGCTCTGTTGGGGTTTAATGG + Intronic
1010227634 6:73505878-73505900 AGAGTTCTGGAGATGGTTGATGG + Intronic
1010238459 6:73594797-73594819 ACAGTTCTGTTGATTTTTTAGGG - Exonic
1012922146 6:105231501-105231523 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1014210102 6:118699612-118699634 AGATTTCTGGAGATGTTTGAAGG + Intronic
1014480247 6:121927427-121927449 AGAGGAGTGTTGATGTTTAAGGG + Intergenic
1015106396 6:129541775-129541797 AGAGTTCTGGAGATGGATAATGG - Intergenic
1015583915 6:134756232-134756254 AGAGATATGATGATGTTTGAGGG - Intergenic
1015860866 6:137678553-137678575 AGTGTTCTGATGCTGTTGAAAGG + Intergenic
1016183756 6:141176973-141176995 AGAGTTCTGCTCATGGTCACAGG - Intergenic
1017231836 6:152081125-152081147 AGAGTTCTGTAGATGTCTATTGG - Intronic
1018368333 6:163144976-163144998 TGAGCCCTGCTGATGTTGAAAGG + Intronic
1018454555 6:163940497-163940519 AAAGTGCTTCTGATGTGTAATGG + Intergenic
1019122384 6:169813503-169813525 AGGGTTATGTTGATGGTTAATGG + Intergenic
1019836273 7:3387629-3387651 AGAGTTCTGGGGATGTATAGTGG + Intronic
1019939772 7:4280380-4280402 TGTGTTCTGCTGTTGTTGAATGG - Intergenic
1021356857 7:19660297-19660319 AGAGTTCTGCTCATGTCTGCAGG + Intergenic
1022784127 7:33619532-33619554 TGCGTTCTGCTGCTGTTGAATGG - Intergenic
1023676873 7:42640084-42640106 AGAGTTCTTCAGATGTGTCACGG + Intergenic
1027147334 7:75705107-75705129 AGAGTTCTGCCGATGGATAGCGG - Intronic
1028081965 7:86588453-86588475 AGAGTTCTGTAGATGTCTATAGG - Intergenic
1028992816 7:97067924-97067946 AGAGTTGTGCTGAGATATAAAGG - Intergenic
1029026414 7:97421526-97421548 AGAGGTCAACTGAGGTTTAAAGG - Intergenic
1030939609 7:115629946-115629968 AAAGTTTTGCTGTTATTTAATGG + Intergenic
1031771890 7:125854115-125854137 AGATTTCTGCTGGTGTTTGAAGG - Intergenic
1032628903 7:133625296-133625318 AGACTTGTGGTGATGTTTAAGGG - Intronic
1032645074 7:133814778-133814800 AAATTTCTTCTAATGTTTAATGG + Intronic
1033149387 7:138899969-138899991 AGAGTTTTGCTGGAGTCTAAAGG - Intronic
1037623142 8:20584627-20584649 CTAGTTCTGCTGATGTCTCAAGG - Intergenic
1037781224 8:21870476-21870498 TGAATTTTGCTGAGGTTTAAGGG - Intergenic
1037821707 8:22138347-22138369 TGACTCCTGCTGATGGTTAAGGG - Exonic
1039275728 8:35932853-35932875 AGAGTTCCGCTCATGGTTACAGG - Intergenic
1039362915 8:36899721-36899743 AGAGTTCTGCTGATGTTTAATGG - Intronic
1040473643 8:47758056-47758078 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1040526916 8:48233772-48233794 AGAGTTCTGCTCATGGCTACAGG - Intergenic
1042301945 8:67293244-67293266 TCAGTTCTGCAGTTGTTTAAGGG + Intronic
1042701873 8:71624482-71624504 AGAGTTCTGCTGATGCCAAGTGG - Intergenic
1043149664 8:76698972-76698994 AGCTTCCTGCTGATGTTTCAGGG - Intronic
1043529168 8:81130712-81130734 AGATTTCTGTTGCTGTTTACTGG + Intergenic
1043976384 8:86589830-86589852 AGAGTTCTGTAGATGTCTATTGG + Intronic
1044771118 8:95635243-95635265 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1044911596 8:97065518-97065540 TGAGTTCTGCCGAAGCTTAAAGG - Intronic
1046255485 8:111691865-111691887 AGTGTTCTGTAGATGTTTATTGG + Intergenic
1046540747 8:115579113-115579135 AGAGTTCTGGTGAGGATGAAAGG + Intronic
1046642189 8:116744326-116744348 AAAATGCAGCTGATGTTTAAAGG + Intronic
1050716910 9:8539695-8539717 GGGGTTTTGCTGATGTTTACTGG - Intronic
1052160403 9:25250574-25250596 AGAGTTCTGGAGATGGTTGATGG + Intergenic
1052255058 9:26446197-26446219 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1054934191 9:70669213-70669235 AGGTGTCTGCTGATGTTTGAAGG - Intronic
1055237797 9:74145015-74145037 ACAGTTCTTGTGATGTATAATGG - Intergenic
1055616426 9:78077593-78077615 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1056445341 9:86660678-86660700 AGTGTTCTGAGGATGTTTAAGGG - Intergenic
1057246859 9:93463477-93463499 AGATTTTTGTTGCTGTTTAAAGG - Intronic
1058085796 9:100746960-100746982 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1060037878 9:120273556-120273578 AGAGTTCTGCAGATGACTATTGG + Intergenic
1203521112 Un_GL000213v1:44842-44864 ATCGTTCTGCGGATGTTAAAAGG - Intergenic
1187355637 X:18567941-18567963 AGTGTTCTGAGCATGTTTAAAGG - Intronic
1187713363 X:22076574-22076596 AGAATTCTATTAATGTTTAAAGG + Intronic
1189087510 X:38041413-38041435 ACAGTTCTCCTGGTGTTTTATGG - Intronic
1189345244 X:40236141-40236163 AGAGTTCTGGAGATGGATAATGG - Intergenic
1190363467 X:49670510-49670532 AGAGTTCTGCAGGTGTATAGGGG + Intergenic
1191115647 X:56849403-56849425 AGAGTTCTGTAGATGTCTATTGG - Intergenic
1191567480 X:62558088-62558110 AGAGTTCTGCAGATGTCTATTGG - Intergenic
1191962743 X:66721253-66721275 AGAGTTCTGTAGATGTCTATAGG - Intergenic
1192371168 X:70514286-70514308 AGAGTTTTGGTGAAGTTAAAAGG + Intergenic
1193054445 X:77135469-77135491 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1193056963 X:77162567-77162589 AGAGTTCTGCAGACGTCTATTGG - Intergenic
1194047431 X:89025489-89025511 AGCATTCTGGTGATTTTTAAAGG - Intergenic
1195270389 X:103222961-103222983 AGAGTTCTGTAGATGTCTAACGG - Intergenic
1196276562 X:113772860-113772882 GGAGTTCTCATGAGGTTTAATGG - Intergenic
1196950154 X:120868815-120868837 ATAGTTCTGCTGATGCTCGATGG - Intergenic
1197808363 X:130418466-130418488 GGAGTTCTGGGGATGGTTAATGG - Intergenic
1197956958 X:131961725-131961747 AGAGTTCTGGAGATGTCTATTGG + Intergenic
1198421685 X:136474799-136474821 AGAGTTTGGCTGATTTATAATGG - Intergenic
1198529834 X:137541317-137541339 AGAATTATGTTGATGATTAACGG - Intergenic
1199307987 X:146290382-146290404 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1199939361 X:152610043-152610065 AGAGTTCTGTAGATGTCTATTGG + Intergenic
1201312322 Y:12607903-12607925 AGAGTTCTGCTCATGGCTACAGG + Intergenic
1201448982 Y:14089367-14089389 AGTTTTCTTCTGTTGTTTAATGG + Intergenic