ID: 1039362918

View in Genome Browser
Species Human (GRCh38)
Location 8:36899767-36899789
Sequence AGTTTTCTGCACAACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039362915_1039362918 23 Left 1039362915 8:36899721-36899743 CCATTAAACATCAGCAGAACTCT 0: 1
1: 0
2: 0
3: 20
4: 323
Right 1039362918 8:36899767-36899789 AGTTTTCTGCACAACATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039362918 Original CRISPR AGTTTTCTGCACAACATGGA AGG Intronic
No off target data available for this crispr