ID: 1039364436

View in Genome Browser
Species Human (GRCh38)
Location 8:36915632-36915654
Sequence CAGTGTGAACAGGGTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 401}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039364436_1039364441 -6 Left 1039364436 8:36915632-36915654 CCTCCTTCACCCTGTTCACACTG 0: 1
1: 0
2: 5
3: 38
4: 401
Right 1039364441 8:36915649-36915671 ACACTGGCTATTTCCCACCATGG No data
1039364436_1039364442 -5 Left 1039364436 8:36915632-36915654 CCTCCTTCACCCTGTTCACACTG 0: 1
1: 0
2: 5
3: 38
4: 401
Right 1039364442 8:36915650-36915672 CACTGGCTATTTCCCACCATGGG No data
1039364436_1039364446 21 Left 1039364436 8:36915632-36915654 CCTCCTTCACCCTGTTCACACTG 0: 1
1: 0
2: 5
3: 38
4: 401
Right 1039364446 8:36915676-36915698 TTTATCACAACCCTTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039364436 Original CRISPR CAGTGTGAACAGGGTGAAGG AGG (reversed) Intronic
901165236 1:7216143-7216165 CAGGAGGAAGAGGGTGAAGGGGG + Intronic
901181088 1:7342316-7342338 CAGTGCTAAAAGGGTGGAGGGGG - Intronic
901622219 1:10597732-10597754 CTGTGTGAAGAGGGTAAAGAGGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902702621 1:18182983-18183005 CAGTTTGCAGCGGGTGAAGGAGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903773959 1:25781239-25781261 CAGAGTGCAAAGGGTCAAGGTGG + Intronic
903776509 1:25797538-25797560 AAGTGTGAAGAGGGAGGAGGAGG - Intergenic
903789104 1:25880721-25880743 CAGTGTGAGCACGGTGCAGTGGG + Intergenic
904690038 1:32286972-32286994 CAGAGGGAACAGGGTGAGGCAGG + Intergenic
904987706 1:34565560-34565582 GAGTGTGAAGGGGGAGAAGGTGG + Intergenic
905059843 1:35130557-35130579 CAGTGTTAACAGGGTGTGGAAGG - Intergenic
908308119 1:62846249-62846271 CAATGTGAAGAAGGTGTAGGAGG - Intronic
908549098 1:65191569-65191591 CAATGTGAACAGGGTGAAAGGGG + Intronic
910118635 1:83760274-83760296 CAGGGTGAACAGCTTGCAGGAGG + Intergenic
912005597 1:104896110-104896132 CAGTGGGAAAAGGGGGAATGGGG + Intergenic
912111166 1:106345090-106345112 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912551413 1:110487847-110487869 CAGTGTGATAAGGGTGCAGCAGG + Intergenic
913209295 1:116570158-116570180 CAATGTGTGGAGGGTGAAGGAGG + Intronic
913306817 1:117436754-117436776 CAGTGTGATTGGGGTGGAGGTGG + Intronic
915936338 1:160092249-160092271 CAGAGTGAGGAGGGTGGAGGGGG + Intronic
916108008 1:161444667-161444689 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916109594 1:161452047-161452069 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916111178 1:161459456-161459478 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916112767 1:161466838-161466860 GAGTCTGAAGAGGCTGAAGGAGG - Intergenic
916552247 1:165860105-165860127 CTGCGTGCACAGGGTTAAGGTGG - Intronic
916683813 1:167126934-167126956 CAGTGAGAACAAGGAGGAGGTGG + Exonic
917076821 1:171214467-171214489 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
917085371 1:171299528-171299550 CCATGTGACCAGGATGAAGGGGG - Intergenic
917763656 1:178193596-178193618 AAGAAAGAACAGGGTGAAGGAGG - Intronic
918056775 1:181028371-181028393 CAGTGTGTAGAGGGTGACAGTGG - Intergenic
918174993 1:182035788-182035810 CAGTTTGCACTGGGAGAAGGAGG + Intergenic
920279523 1:204832149-204832171 CTGTGTGAACAAGGTGAACCCGG + Intronic
921546699 1:216482421-216482443 CAGTGAGGACAGGGTCCAGGTGG - Intergenic
922567780 1:226612123-226612145 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
922681960 1:227606246-227606268 CGGGGTGAATAGGGTGATGGTGG + Intronic
923913918 1:238481781-238481803 CAGTTTGCAAAGGGAGAAGGAGG + Intergenic
924448479 1:244156294-244156316 CAGTGGGTAGAGGGTGAGGGAGG - Intergenic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1065318001 10:24483363-24483385 CAATGAGAACAGGCGGAAGGTGG - Intronic
1065318378 10:24486186-24486208 CACTGAGAACAGGCTGAAGGTGG - Intronic
1065731541 10:28713820-28713842 CACAGGGAAAAGGGTGAAGGAGG - Intergenic
1066986119 10:42468440-42468462 AAATGTGCAAAGGGTGAAGGGGG + Intergenic
1067220717 10:44342200-44342222 GAGTCTGAACAGGATGAAAGGGG - Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1069582597 10:69575880-69575902 AAGTGTGAAGAAGGAGAAGGAGG - Intergenic
1069728690 10:70597658-70597680 CAGTTTGGACAGGGTGAATCGGG + Exonic
1070650240 10:78230080-78230102 CAATGTGAGTATGGTGAAGGTGG - Intergenic
1071012298 10:80953051-80953073 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1071971816 10:90915651-90915673 CAGAGTCAACAGGTTCAAGGTGG + Intronic
1072297614 10:94026417-94026439 TAGTGTGAACAGGTTTATGGGGG - Intronic
1076060542 10:127410837-127410859 CAGTTTTTACAGGGTGAACGAGG + Exonic
1076163767 10:128266084-128266106 CAGAGAGAAAAGGGTGAAAGAGG - Intergenic
1076769673 10:132656156-132656178 CAGTGGGGACAGGGTGCAAGAGG + Intronic
1076869234 10:133185312-133185334 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869238 10:133185358-133185380 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869240 10:133185381-133185403 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1077184855 11:1231423-1231445 GGGTGTGAACAGGGTGATGTTGG - Exonic
1077509728 11:2951790-2951812 CAGTTTGAAGAAGGTGAAGAAGG - Exonic
1077722763 11:4644392-4644414 GTGTGTGAACAGGGTGAACGTGG + Intronic
1079360451 11:19766351-19766373 AAGTGTGAACATGGTGATGGGGG + Intronic
1079505563 11:21148658-21148680 CAGTGTGAAAGGTGTGCAGGGGG - Intronic
1080759908 11:35238402-35238424 CAGAAAGAAGAGGGTGAAGGTGG + Intergenic
1081632847 11:44701320-44701342 CAATGGGAACAGGCTGAATGGGG + Intergenic
1081832684 11:46127367-46127389 CGGTGTGTACAGGGTGAGGGTGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083628447 11:64083878-64083900 GAGTGTGAGCAGCGTGCAGGCGG + Intronic
1083715431 11:64572509-64572531 CAGTGTACACAGGGTGAAAGAGG - Exonic
1083879561 11:65541331-65541353 CAGGGTGGACAGGGCCAAGGGGG - Intronic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1083962226 11:66020860-66020882 CAAGGTGAAGAGGGTGAAGATGG + Exonic
1084547268 11:69820651-69820673 CAGCGTGCACAGGGTCCAGGTGG + Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085300559 11:75455902-75455924 CACTGGGAACAGGGAGATGGAGG + Intronic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1086151328 11:83614045-83614067 CAGTGTGAACTTGATGAAGTAGG + Intronic
1087424384 11:97969554-97969576 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
1087999694 11:104862377-104862399 GAGTGGGAACTGGGTGATGGAGG + Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089185983 11:116615017-116615039 CAGTTTGGACAGGGTCATGGAGG - Intergenic
1090740424 11:129654606-129654628 CAGTGTGGAGAGGGAGCAGGTGG - Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091551434 12:1538092-1538114 CAGTGGGAACAGGCTGAGCGTGG + Intronic
1091650603 12:2306287-2306309 CAGAGCGCACAGGCTGAAGGTGG - Intronic
1092679180 12:10958398-10958420 CTATGTGAACAGAGAGAAGGAGG + Intronic
1098805507 12:75016468-75016490 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1098809221 12:75063573-75063595 CAGTGTGTTGAGGGTGATGGTGG + Intronic
1100268784 12:93003737-93003759 CAGTGAGCACAGGGAGGAGGAGG + Intergenic
1100412919 12:94340310-94340332 CTGTGTGGAGTGGGTGAAGGAGG - Intronic
1101236084 12:102791852-102791874 CAGTGTGGTCAGGCTGAAGGTGG + Intergenic
1101475847 12:105047434-105047456 CAGTCTAAACAGGAAGAAGGAGG - Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103870139 12:124085457-124085479 CTGGGGGAACAGGGTGATGGGGG + Intronic
1105049367 12:133035032-133035054 CAGGGTGCACACTGTGAAGGGGG - Intergenic
1105587959 13:21762068-21762090 CAGTGAGGAAAGGGTGAGGGGGG - Intergenic
1106231290 13:27823227-27823249 AAGTGTGTGCAGGGCGAAGGCGG - Intergenic
1107098298 13:36560315-36560337 CTGTCTGCACAGTGTGAAGGAGG - Intergenic
1107404231 13:40097978-40098000 CAGTGTGGACAGGGAGGAAGAGG + Intergenic
1108000127 13:45898051-45898073 CAGTGTGATGAGGCTGAAGTAGG + Intergenic
1108082470 13:46750917-46750939 GAGTGTGGAAAGGATGAAGGAGG - Intronic
1108288106 13:48928683-48928705 CACTTTGAAAAGGGGGAAGGAGG + Intergenic
1109013016 13:56974655-56974677 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1109161467 13:58980477-58980499 TGGGGTGCACAGGGTGAAGGTGG - Intergenic
1109561247 13:64052900-64052922 CAGTTTGTACAGGGAGAAGGAGG + Intergenic
1110187348 13:72690827-72690849 CATTGTAAAAAGGGTGCAGGAGG + Intergenic
1110832850 13:80051577-80051599 CAGTGTGAACATGATGATGGAGG - Intergenic
1111133013 13:84000269-84000291 CAGTTTGCACAGGGAGATGGAGG - Intergenic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1112549243 13:100404231-100404253 CAGTTTGCACAGGGAGAAGGAGG + Intronic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1115372101 14:32628182-32628204 CAGTGAGGAAAGGGTCAAGGAGG + Intronic
1116681408 14:47974479-47974501 AAGTGGGATCAGGGTGGAGGAGG + Intergenic
1117061855 14:51971821-51971843 CAGGGTCAACTGGGTGAAAGTGG - Intronic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1117895126 14:60476255-60476277 CAGTATGAATAGGGTGGATGTGG - Intronic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119775073 14:77243165-77243187 CAGTGCGAACATTGTGGAGGTGG + Intronic
1120443105 14:84562861-84562883 CAGATTGGACAGGGTGGAGGTGG + Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122626624 14:103088342-103088364 GAGTGTGAACAGGCAGGAGGCGG - Intergenic
1122693583 14:103542560-103542582 CAGTGTGACCCTGGTGATGGGGG - Intergenic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1124014747 15:25864955-25864977 CAGTGTGGACTGGCTGAAGCTGG - Intronic
1124391219 15:29259633-29259655 GAGGGTGAGCAGGGTGTAGGGGG - Intronic
1125372858 15:38997065-38997087 CAGAGTGAACAGCGTGTATGTGG + Intergenic
1125600512 15:40912969-40912991 AAGGGGGAACAGGGAGAAGGAGG + Intergenic
1126522796 15:49615532-49615554 CAGGAGGAAAAGGGTGAAGGGGG - Intronic
1127280812 15:57490716-57490738 CAGAGTGTACAGGATGAAGTGGG + Intronic
1127963620 15:63908083-63908105 CATTGGGAACAGGGTGATTGAGG - Exonic
1129197835 15:73981750-73981772 CGGTGTGAAGAGGGAGGAGGAGG - Exonic
1129367990 15:75068749-75068771 CAGAGTGCAGTGGGTGAAGGAGG + Intronic
1129773888 15:78221273-78221295 TGGGGTGAACAGGGTGATGGTGG + Intronic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1131149260 15:90036725-90036747 CTGTGTGAAGAGGATGAGGGGGG - Intronic
1132542076 16:514881-514903 CAGAGTGAACTGGGTGAACGTGG + Intronic
1132876829 16:2143643-2143665 CATGGTGAGCAGGCTGAAGGGGG + Intronic
1133041130 16:3060132-3060154 GAGTGGGGACAGGGTGAACGAGG - Exonic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1134291859 16:12907895-12907917 CAGAGTGAATTGGGTGGAGGTGG - Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135186504 16:20320414-20320436 CAGGGAGATCAAGGTGAAGGTGG - Exonic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135916940 16:26613744-26613766 CAGTGTGCACAGGGTGTGAGAGG - Intergenic
1136485852 16:30571385-30571407 CCCTGTGAACCCGGTGAAGGAGG + Intronic
1137669024 16:50268615-50268637 CCGGGTGATGAGGGTGAAGGTGG + Intronic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139038319 16:62974648-62974670 AGGTGTGAACAGGGTGAAATTGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140813823 16:78603037-78603059 AATTGTGAACGGGGTGGAGGTGG + Intronic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1141562274 16:84877417-84877439 CACTGTGAACAGGAGCAAGGGGG - Exonic
1142229455 16:88892987-88893009 CACTGTGAACAGGGAGCAAGGGG + Intronic
1142337876 16:89502020-89502042 CAGTGTGGACATGGAGCAGGAGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143057850 17:4175820-4175842 CAGTATGAACAGGGTCAAACAGG + Intronic
1143096484 17:4481039-4481061 CAGGGTGAGGAGGGTGAGGGAGG + Intronic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1143322350 17:6076297-6076319 CAGTGTGAATAGGTTGAACTGGG - Intronic
1143513837 17:7409493-7409515 GAGTGTGAACAGGGTGCAATAGG + Intronic
1144009266 17:11130515-11130537 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1144945198 17:18966183-18966205 CAGTTTGTGCAGGGTGAATGTGG + Intronic
1145995895 17:29104770-29104792 GAGTGAGAACAGAGTCAAGGGGG + Intronic
1147785448 17:42975225-42975247 CAGTGTGAAAAGTGTGGTGGTGG + Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1148910089 17:50937648-50937670 CAGTGTGGAACGGGAGAAGGGGG - Intergenic
1149298703 17:55284777-55284799 CAATTTGAACAGGGTGTTGGGGG - Intronic
1151141157 17:71993361-71993383 CAGTGGGAAGAGGCTGCAGGGGG - Intergenic
1151230097 17:72678325-72678347 CCCTGTGAACAGCGAGAAGGAGG + Intronic
1151871202 17:76838132-76838154 CCGTGTGCTCAGGGCGAAGGTGG - Intergenic
1151945334 17:77316507-77316529 TAGTGTGCACAGCGTGCAGGAGG + Intronic
1152747166 17:82046401-82046423 CAGTGTGGACAGGGGTGAGGAGG - Intergenic
1154050117 18:10946573-10946595 CAGTGTCATCAGGGTTGAGGAGG + Intronic
1154937808 18:21078647-21078669 CAGGCTGGACAGGGTCAAGGTGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155839699 18:30630158-30630180 CAGATTGAACAGGGTCAAGGTGG + Intergenic
1156190620 18:34716030-34716052 CAGTGTACACTGGGTGCAGGTGG + Intronic
1156897216 18:42259420-42259442 GAGTGTGAGCAGGATGAAGTTGG - Intergenic
1157103748 18:44753768-44753790 CAGTGACAGCAGGGTGAGGGAGG + Intronic
1157110294 18:44814134-44814156 CAGTGGGAGTAGGGTGATGGGGG + Intronic
1157522142 18:48352596-48352618 CAGGGTGAGCAGGCTGGAGGAGG + Intronic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1159082840 18:63754754-63754776 CAGTGTGAAAACAGTGATGGTGG - Intronic
1159457683 18:68682034-68682056 TAGTGTGCACTGGGTGCAGGTGG + Intronic
1159582980 18:70253666-70253688 CAGGGTGCTGAGGGTGAAGGGGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160527513 18:79546236-79546258 GAGTGTGGAGAGGGTGAGGGTGG - Intergenic
1160527524 18:79546281-79546303 GAGTGTGAAGAGGGTGAATGTGG - Intergenic
1160527531 18:79546326-79546348 GAGTGTGGAGAGGGTGAATGTGG - Intergenic
1160527547 18:79546401-79546423 GAGTGTGGAGAGGGTGAATGTGG - Intergenic
1160527557 18:79546446-79546468 GAGTGTGGAGAGGGTGAATGTGG - Intergenic
1160527565 18:79546491-79546513 GAGTGTGGAGAGGGTGAATGTGG - Intergenic
1160532751 18:79575162-79575184 CAGTGTGACCGTGGTGCAGGTGG + Intergenic
1161389151 19:4012133-4012155 CAGTGTCCACAGGGCCAAGGAGG + Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1163811177 19:19432767-19432789 CAGAGTGAGCAGGCTGAAGTGGG + Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165472804 19:36013309-36013331 CAGGGTGCAGAGGGTGAAGGAGG - Intronic
1165993336 19:39828068-39828090 AGATGTGAACAGGGTGAAGTTGG - Intronic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1166473750 19:43102633-43102655 CAGGCTGGACAGGGTCAAGGTGG + Intronic
1166487701 19:43227698-43227720 CAGGCTGGACAGGGTCAAGGTGG + Intronic
1166494534 19:43289570-43289592 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
1167007190 19:46783821-46783843 CAGTTTGAGCAGGTTGAGGGTGG + Intronic
1167669925 19:50844888-50844910 AAGTGTGAAAAGTGTGAAGGGGG - Intergenic
1168458735 19:56537006-56537028 TAGAGTGAATAGGGAGAAGGGGG + Intergenic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
1168700688 19:58437663-58437685 CAGTGTGAACAGGGAGGGGTTGG - Intronic
925185625 2:1844249-1844271 CAGTGAGAACAGGGTGCTGCGGG - Intronic
925296588 2:2781156-2781178 GAGTGTGCAGAGTGTGAAGGTGG - Intergenic
925379249 2:3413734-3413756 CAGTGTGCACAGGGATGAGGTGG + Intronic
925722707 2:6844063-6844085 CAGGGTGGACAGGGTTGAGGTGG + Intronic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926926994 2:17996825-17996847 CAGTTTGCACAGGGAGAGGGAGG - Intronic
926953643 2:18271430-18271452 CAGCGGGAGCAGGGTGGAGGAGG - Intronic
927665514 2:25029455-25029477 CAGTGAGAACAGGTTCAAGTAGG + Intergenic
928482022 2:31692685-31692707 CAGGCTGAACAGGGTTGAGGTGG + Intergenic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
928682570 2:33717379-33717401 CAGTGGGAACAGGATGGAAGCGG + Intergenic
928964738 2:36966033-36966055 GAGTGAGAACAGGGTCGAGGTGG + Intronic
930226168 2:48795877-48795899 CAGTGGGCACAGGATAAAGGAGG - Intergenic
930942970 2:57035806-57035828 CAGTGGCAACAGGGTGGTGGTGG + Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933727722 2:85436020-85436042 CAGTCTGCACAGGGTCGAGGTGG + Intronic
933863120 2:86489786-86489808 CAGATTGAATAGGCTGAAGGTGG + Intronic
934619093 2:95793286-95793308 CAATGTGATCCTGGTGAAGGAGG + Intergenic
934641798 2:96031271-96031293 CAATGTGATCCTGGTGAAGGAGG - Exonic
934853857 2:97717235-97717257 GAGTGGGAACAGGGTGGTGGGGG + Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935734614 2:106096914-106096936 TGGTGTGAATAGGGTGCAGGCGG + Intronic
936598642 2:113873961-113873983 CATTGTGAAGAAGGTGATGGTGG + Intergenic
938137463 2:128770845-128770867 CAGTGGGAAAGGGGTGCAGGGGG - Intergenic
941249866 2:163148315-163148337 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
942226353 2:173820018-173820040 CTCTGTGAAAAGTGTGAAGGAGG + Intergenic
942934831 2:181542148-181542170 AAGTGTGGACAGTGAGAAGGGGG + Intronic
943501332 2:188693245-188693267 CAGTGTAGACAGGGAGCAGGTGG + Intergenic
944153378 2:196585934-196585956 CAGGGAGTACAGGCTGAAGGAGG - Intronic
944320800 2:198339571-198339593 AAGTCTGCACAGGATGAAGGAGG - Intronic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
948771847 2:240255232-240255254 GGCTGTGACCAGGGTGAAGGGGG - Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
1170222275 20:13953185-13953207 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1170782423 20:19437812-19437834 CAGGGGGAACAGGGTGGAGGAGG - Intronic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1175727725 20:61331257-61331279 CAGTGAGAACAGGCTGAGGGAGG - Intronic
1175773162 20:61636300-61636322 CAGTGTGAAAAGGCAGAAAGTGG + Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1175996140 20:62813100-62813122 CAGTGAGAACGGGGTTGAGGAGG + Exonic
1177124713 21:17181861-17181883 CAGATTGGACAGGGTCAAGGTGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1178619533 21:34161614-34161636 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1180086147 21:45508837-45508859 CCATGTGGACAGGGTGCAGGTGG + Intronic
1180186133 21:46140266-46140288 CCCTGTGAACAATGTGAAGGTGG - Intronic
1181484390 22:23221386-23221408 GAAGGGGAACAGGGTGAAGGAGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184257202 22:43294158-43294180 CAGTGGGAAAAGGGTGCAGAGGG - Intronic
1184445674 22:44545489-44545511 GAGGGTGACCAGGGTCAAGGTGG - Intergenic
1184889322 22:47369845-47369867 AAGGGTGGACAGGGAGAAGGAGG - Intergenic
1185174406 22:49313038-49313060 CTGTGTATTCAGGGTGAAGGTGG - Intergenic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
949474842 3:4433579-4433601 CCCCGTCAACAGGGTGAAGGTGG - Intronic
950582845 3:13873858-13873880 CTGAGTGAGCAAGGTGAAGGGGG + Intronic
950804773 3:15590516-15590538 CAGTGAGATCAGGTTGAGGGGGG - Intronic
951222263 3:20081235-20081257 CAGTGTGAACAGGCAGCAGCTGG - Intronic
951345973 3:21547308-21547330 CAGTTTGCACAGGGAGAGGGAGG - Intronic
952905166 3:38135207-38135229 CGGGGTGAACAGGGTGATGGTGG - Intronic
953031061 3:39180335-39180357 CAGTGTGACTAGGGTGATGTGGG + Intergenic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
955746642 3:62147197-62147219 AAGTGTGAACTGGGAAAAGGAGG + Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956557666 3:70540550-70540572 CAGATTGGACAGGGTCAAGGTGG + Intergenic
959859482 3:111200646-111200668 CACTGTGAAAAGGGTCAATGAGG - Intronic
960618701 3:119619211-119619233 CAGTGGGAGCATGGTGAAGCAGG - Intronic
961376770 3:126472377-126472399 CAGTGTGAACAGGGTCTGGTGGG - Intronic
961426816 3:126854922-126854944 CAGTCTCAACAGGTAGAAGGTGG - Intronic
961514537 3:127424522-127424544 GTGTGTGAACAGGGAGAGGGAGG - Intergenic
961514542 3:127424549-127424571 GTGTGTGAACAGGGAGAGGGGGG - Intergenic
961514549 3:127424576-127424598 ATGTGTGAACAGGGAGAGGGAGG - Intergenic
963434026 3:145244957-145244979 CAGTGTGTACAGGAAGATGGAGG + Intergenic
963817257 3:149845398-149845420 CATAGTGAACAGGATGAAGTTGG + Intronic
964304378 3:155325202-155325224 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
964814358 3:160701000-160701022 CAGTGTGGAGAGGGTGCTGGGGG + Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
966050942 3:175617435-175617457 CAGATTGGACAGGGTGGAGGCGG + Intronic
966139621 3:176741085-176741107 TAGAGAGCACAGGGTGAAGGAGG + Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966523742 3:180899523-180899545 CAGTTTGCACAGGGAGAGGGAGG - Intronic
968381509 4:100689-100711 CAGTTTGCACAGGGAGACGGAGG - Intergenic
968384615 4:124989-125011 CATTCTGAACAGGGTAAAGTAGG - Exonic
969046506 4:4340365-4340387 AAGTGTGAACAGGATGGTGGGGG + Intergenic
969884421 4:10202473-10202495 CTGAGGGAACAGGTTGAAGGTGG + Intergenic
970099661 4:12505616-12505638 GAGTGAGAAAAGAGTGAAGGAGG - Intergenic
970550730 4:17178405-17178427 CAGAGTGAACAGGGAAATGGAGG + Intergenic
971859866 4:32089056-32089078 CAGATTGGACAGGGTTAAGGGGG + Intergenic
971946554 4:33286623-33286645 GAGTCTGAATAGGGTGAGGGAGG - Intergenic
974675161 4:65079388-65079410 CAGTTTGAACATGGAGAGGGAGG - Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975195029 4:71514320-71514342 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
975361615 4:73477304-73477326 CAGTGTGGAGAGGGAGCAGGTGG + Intergenic
975756643 4:77578128-77578150 CAGTTTGCACAGGGAGAGGGAGG - Intronic
976345361 4:83993735-83993757 CAGTTTGCATAGGGTGAGGGAGG - Intergenic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
978652786 4:111027297-111027319 CAGTGACAACAGGAAGAAGGAGG - Intergenic
979507425 4:121514302-121514324 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
980495936 4:133587595-133587617 CAGATTGAACAGGGTTGAGGTGG - Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
981259926 4:142707565-142707587 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
981456808 4:144962255-144962277 CAGTTTGCACAGGGAAAAGGAGG - Intergenic
981586671 4:146310877-146310899 CAGTGTGAAACAGGGGAAGGGGG + Intronic
982477620 4:155872637-155872659 CAGTTTGCACAGGGAGAGGGAGG + Intronic
982759744 4:159267073-159267095 CAGTGTGTATAGGGAGAGGGAGG + Intronic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
983526485 4:168765512-168765534 CAGTGTGAAGTGGGTGACAGTGG - Intronic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986262761 5:6162896-6162918 AAGTGTGAACAGGCTGGAGTTGG - Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
989144345 5:38234045-38234067 GAATGAGAACAGAGTGAAGGGGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990842579 5:60100295-60100317 GATGGGGAACAGGGTGAAGGAGG + Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
993013313 5:82508534-82508556 CAGGGTGAGAAGGGTGATGGAGG - Intergenic
994979639 5:106857033-106857055 CACTGTGCACTGGGGGAAGGGGG - Intergenic
995012623 5:107274750-107274772 CAGGGAGAAAAGGGAGAAGGGGG + Intergenic
995060642 5:107808733-107808755 CAAAGTGAACCAGGTGAAGGAGG - Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995715967 5:115082172-115082194 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
995738115 5:115325056-115325078 CCAGGTGAGCAGGGTGAAGGAGG + Intergenic
996666288 5:126064141-126064163 CAATGTGGTCAGGGTGAAAGTGG + Intergenic
999563665 5:152833557-152833579 CAGGGGGAAGAGGGTAAAGGGGG + Intergenic
1000513855 5:162216285-162216307 TAGTGTAAAGAGGGTGAAGAGGG - Intergenic
1001794617 5:174491636-174491658 CAGAAAGAACCGGGTGAAGGTGG - Intergenic
1002113328 5:176936663-176936685 AGGTGTGAACAGGTTGAATGTGG - Intronic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1005582535 6:27248327-27248349 CAGTCTGGACAGGGACAAGGGGG - Intronic
1006145905 6:31959446-31959468 TACTGTGAGGAGGGTGAAGGAGG - Intronic
1006230840 6:32584767-32584789 AAGTGTTCACAGGGTGAACGCGG - Intronic
1006326535 6:33358072-33358094 CAGGGTGCACAGGCTGAAAGAGG - Intergenic
1007227585 6:40325778-40325800 ATGTGGGAACAGGGTGAAAGAGG - Intergenic
1007745273 6:44039642-44039664 CACTGAGCACAGGGTGCAGGGGG - Intergenic
1008366167 6:50683048-50683070 CAGAGTGGTGAGGGTGAAGGTGG - Intergenic
1009907544 6:69888277-69888299 CAGTTTGCACAGGGAGACGGAGG + Intronic
1009907852 6:69891164-69891186 CAGTTTGCACAGGGAGAGGGAGG + Intronic
1010084325 6:71898863-71898885 AAGTGTAAAAAGGGTGACGGTGG - Intronic
1011169333 6:84488734-84488756 AATTGAGAACAGAGTGAAGGGGG + Intergenic
1012595373 6:101032272-101032294 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1012804716 6:103879295-103879317 CAGTTTGCACAGGGAGAAGGAGG - Intergenic
1014198316 6:118583079-118583101 CAGGCTGGACAGGGTCAAGGTGG - Intronic
1014520460 6:122436148-122436170 CAGTGTGAAGACAGTGTAGGGGG + Intergenic
1016454847 6:144220169-144220191 CAGTGTGAACAGGCTGCATTGGG + Intergenic
1016471410 6:144378545-144378567 GGTTGAGAACAGGGTGAAGGAGG + Intronic
1016606126 6:145929836-145929858 CATTGTGAGCAGGTTGAAAGTGG + Intronic
1016730006 6:147418830-147418852 GAGTTTGAAAGGGGTGAAGGTGG - Intergenic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019146168 6:169976794-169976816 AAGTGTGACCAGGGAGGAGGAGG - Intergenic
1019502890 7:1374008-1374030 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1019738044 7:2660090-2660112 CAGTGAGTGCAGGGTGGAGGCGG - Intronic
1020205200 7:6109159-6109181 AAGTGTGAACTGGCTGGAGGTGG + Intronic
1020906789 7:14073537-14073559 CAGTATGAACAGGGAGCAGTGGG - Intergenic
1021927312 7:25545978-25546000 CACTGTGAAAAGGGTGCATGAGG - Intergenic
1023517286 7:41014421-41014443 CAGTGTGAAATTGGAGAAGGAGG - Intergenic
1023558761 7:41450544-41450566 CACACTGGACAGGGTGAAGGCGG + Intergenic
1023828576 7:44025988-44026010 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024154233 7:46603825-46603847 CTGTGTGGAAAGGGTGAGGGAGG - Intergenic
1026187575 7:68094130-68094152 CAGTGGGAACATGGTGATGGTGG - Intergenic
1026334596 7:69382979-69383001 CAGGAGGAACAGGGTGAAAGGGG - Intergenic
1028165627 7:87535159-87535181 CTGTGTGAATAGGCCGAAGGGGG - Intronic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1029738871 7:102480268-102480290 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1029756872 7:102579431-102579453 CAGTGAGATCAGGATGAGGGTGG + Intronic
1029774811 7:102678491-102678513 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1030245854 7:107383995-107384017 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1032520939 7:132544534-132544556 AAGTGTGCAGAGGGTGAGGGGGG + Intronic
1033571358 7:142631964-142631986 CAGTGTGAACAGAGTTGATGCGG + Intergenic
1034944366 7:155252449-155252471 CTGTGTGAACAGTTTGTAGGAGG - Intergenic
1037492642 8:19410643-19410665 GAGGTTGAACAAGGTGAAGGGGG + Intronic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039813173 8:41068094-41068116 CAATGTGAACAACCTGAAGGTGG + Intergenic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1040758441 8:50808811-50808833 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1046193758 8:110833048-110833070 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1049090108 8:140508349-140508371 CAGTTTGCACAGGCTGGAGGTGG - Intergenic
1049304005 8:141888915-141888937 TACTTTGAATAGGGTGAAGGAGG - Intergenic
1049473753 8:142787585-142787607 GAGTATAAAGAGGGTGAAGGCGG - Intergenic
1049963174 9:755745-755767 CAGTGGGAACAGGCTGGAGATGG - Intergenic
1050929766 9:11308402-11308424 CAGTTTTCACAGGGAGAAGGAGG - Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1056285529 9:85083869-85083891 CCCTGAAAACAGGGTGAAGGAGG - Intergenic
1056307453 9:85303946-85303968 AAGAGTGGGCAGGGTGAAGGGGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1058315881 9:103565125-103565147 TGGTTTGAACAGGGTGAGGGAGG + Intergenic
1059579763 9:115531716-115531738 AATTGGGAACAGGTTGAAGGAGG + Intergenic
1060367711 9:123035132-123035154 CACGATGAACAGGGTGAAGTAGG - Exonic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061246192 9:129402237-129402259 GAGAGGGAAGAGGGTGAAGGAGG - Intergenic
1061732725 9:132628947-132628969 CTGTGAGAACAGGGTCAGGGAGG + Intronic
1185932530 X:4219022-4219044 CAGTGTGTACTGGCTGAAGGTGG + Intergenic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187563345 X:20423368-20423390 CATGGTGAAAGGGGTGAAGGAGG - Intergenic
1189063058 X:37774993-37775015 CATTGTGAGCAGGTTGAAAGTGG - Intronic
1189414575 X:40802844-40802866 CAGATTGGACAGGGTCAAGGTGG + Intergenic
1192681076 X:73254594-73254616 CAGTTTACACAGGGAGAAGGAGG + Intergenic
1192948479 X:75990735-75990757 AAGTGTGAAAAAGCTGAAGGGGG + Intergenic
1193352333 X:80477946-80477968 CAGGCTGGACAGGGTCAAGGTGG - Intergenic
1193945036 X:87724313-87724335 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194066326 X:89266724-89266746 CAGTTTGTACAGGGAGAGGGAGG + Intergenic
1194131168 X:90084094-90084116 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195465541 X:105174741-105174763 CAGAGCGTACAGGGTGAGGGTGG - Intronic
1195721917 X:107876046-107876068 CAGATTGGACAGGGTCAAGGTGG + Intronic
1197038715 X:121908545-121908567 CAGTTTGTACAGGGAGAGGGGGG - Intergenic
1197062351 X:122196142-122196164 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197509268 X:127350698-127350720 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic
1197721058 X:129744957-129744979 CAGTGTGAACAGTGTGGGGGCGG + Intronic
1198393809 X:136202970-136202992 CAGTGTGCTCAGGATGAAGTTGG - Intronic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1200720496 Y:6600843-6600865 CAGTTTGTACAGGGAGAGGGAGG + Intergenic