ID: 1039366660

View in Genome Browser
Species Human (GRCh38)
Location 8:36935183-36935205
Sequence CAGTGGGAAGAGGGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1592
Summary {0: 1, 1: 0, 2: 15, 3: 159, 4: 1417}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039366660_1039366669 12 Left 1039366660 8:36935183-36935205 CCGTCTTCCCCCTCTTCCCACTG 0: 1
1: 0
2: 15
3: 159
4: 1417
Right 1039366669 8:36935218-36935240 AGCGCAGCAAGGCCCAGAGAAGG No data
1039366660_1039366670 15 Left 1039366660 8:36935183-36935205 CCGTCTTCCCCCTCTTCCCACTG 0: 1
1: 0
2: 15
3: 159
4: 1417
Right 1039366670 8:36935221-36935243 GCAGCAAGGCCCAGAGAAGGAGG No data
1039366660_1039366668 1 Left 1039366660 8:36935183-36935205 CCGTCTTCCCCCTCTTCCCACTG 0: 1
1: 0
2: 15
3: 159
4: 1417
Right 1039366668 8:36935207-36935229 AACAAAAGATGAGCGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039366660 Original CRISPR CAGTGGGAAGAGGGGGAAGA CGG (reversed) Intronic
900099864 1:957299-957321 CAGTGGGAAGTGGAAGTAGAGGG + Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
900862675 1:5244439-5244461 CGGTGGGAAGAGGCGCAGGACGG - Intergenic
901004398 1:6164900-6164922 CAGGGGGAAGAGAGAAAAGACGG + Intronic
901165236 1:7216143-7216165 CAGGAGGAAGAGGGTGAAGGGGG + Intronic
901193399 1:7425872-7425894 CAGGGAGAAGATGGGGAAGCTGG - Intronic
901622219 1:10597732-10597754 CTGTGTGAAGAGGGTAAAGAGGG + Intronic
901675375 1:10880381-10880403 CAAGGTGAAGAAGGGGAAGAAGG - Intergenic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
901922928 1:12549027-12549049 CAGTGGGGAGGCGGGGGAGAAGG - Intergenic
902091766 1:13909373-13909395 CAGGGGCAAGAGGGTGAGGAGGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902786076 1:18733577-18733599 CAGAGGGAAAAGGTGGAGGAGGG + Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
902806366 1:18863635-18863657 CAGTGCAAAGAGGGCAAAGAGGG - Intronic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
902993147 1:20203709-20203731 CAGTAGAAAGAAGAGGAAGATGG + Intergenic
903132978 1:21291088-21291110 GAGGGGGAAGATGGGAAAGAAGG - Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903357793 1:22758712-22758734 CAGTGGTATGAGGGGCAAGCTGG + Intronic
903560370 1:24222428-24222450 GAGTGGGAAGAGGGAGGAGCAGG + Intergenic
903603348 1:24557626-24557648 AAGTGGGGAGAGGGGACAGAAGG + Intronic
903740313 1:25554868-25554890 CAGTGGGAAGAAGCTGCAGAAGG + Exonic
903756285 1:25663664-25663686 CAGTGGGACGAATGGGGAGATGG + Intronic
903774002 1:25781489-25781511 CTGTGGGAAGAGGAGGGAGGTGG - Intronic
903935503 1:26892339-26892361 CAGTGGGAAGAGGGAAACCAGGG + Intronic
904062972 1:27725858-27725880 AAGTGGGAAGGGGCGGAACACGG - Intergenic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
904306561 1:29593914-29593936 AAGGGGGAAGAGGGAGGAGAAGG + Intergenic
904420633 1:30388911-30388933 AACTGGGAAGAGTGGGAAGGGGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904499959 1:30908095-30908117 CACTGGGAGGTGGGGGAACAGGG + Intronic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905033229 1:34901318-34901340 GAGTGGGCAGAGGGGTAGGAGGG + Intronic
905315424 1:37079764-37079786 CCGTGGGGAGAGGAGGGAGAGGG - Intergenic
905440929 1:37996328-37996350 CCTTGGGAAGAGGGGGAAGGGGG + Intergenic
905446513 1:38031262-38031284 GAGTGGGGAGCAGGGGAAGAAGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906509161 1:46401073-46401095 GGGAGGGAAGAGGGGGAAGTGGG + Intronic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
906676753 1:47698772-47698794 CAGTGGGTGGAGGGGGGCGAGGG - Intergenic
906686724 1:47767757-47767779 CAGTGGGAAGCGTGGCAGGAAGG - Intronic
906915121 1:50000903-50000925 CAGGGGGAAGGGTGGGAGGAGGG + Intronic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
906999353 1:50834135-50834157 CAGGAGGAAGAGGGCGAAGCGGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907604308 1:55801632-55801654 GAGGTGGAAGAGGGCGAAGAGGG - Intergenic
907849112 1:58236979-58237001 TAGTGGGAAGAGGGAGTATAAGG - Intronic
908162654 1:61426283-61426305 CAGTCAAAAAAGGGGGAAGAGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908433153 1:64078730-64078752 CACAGGTAAGAGGGGGCAGAAGG + Intronic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909084360 1:71154190-71154212 CACTTGGAAGAGGGCCAAGAGGG - Intergenic
909097330 1:71304050-71304072 CAGGAAGGAGAGGGGGAAGAAGG + Intergenic
909388320 1:75086633-75086655 TTGTGGGAAGTGGAGGAAGAGGG + Intergenic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
909524384 1:76606561-76606583 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909706919 1:78596517-78596539 CAGGAGGCAGAGTGGGAAGAGGG - Intergenic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910865985 1:91788339-91788361 GAGAGGGAAGAAGGGAAAGAAGG + Intronic
911196002 1:94996384-94996406 CAGTGGGAAGAAGGAGATGTGGG + Intronic
911224543 1:95290890-95290912 CAGAGGGAGGACGGGGAATAGGG - Intergenic
911272144 1:95815183-95815205 CATGGGGAAGAGTGTGAAGAAGG + Intergenic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
912005597 1:104896110-104896132 CAGTGGGAAAAGGGGGAATGGGG + Intergenic
912503407 1:110137461-110137483 CATGGGGAAAAGGGTGAAGAAGG - Intergenic
912554149 1:110504126-110504148 CAGCTGGAAGAGGGGAGAGAGGG + Intergenic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
912735327 1:112145106-112145128 CAGGGGGAGGATGGGGCAGAAGG + Intergenic
912852763 1:113141208-113141230 GGTGGGGAAGAGGGGGAAGAAGG - Intergenic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
914001949 1:143702049-143702071 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
914452883 1:147808440-147808462 CAGTGGTTGGATGGGGAAGAAGG - Intergenic
914513103 1:148351905-148351927 CAGGTGGAAGAGGGGCAACAGGG + Intergenic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915895771 1:159809570-159809592 CACTGGGAAGAGGAGGGAGGTGG - Exonic
915974296 1:160375005-160375027 GAGTGGGAAGAGGAGGGAGCAGG + Intergenic
916063572 1:161118594-161118616 CAGTGGGAAGATGGAGAAAGGGG - Intronic
916291828 1:163175288-163175310 CAGAGGGAAGAGGGCCCAGAGGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916891832 1:169119539-169119561 CAGTAGAAAGAGGGGCATGATGG + Intronic
917503704 1:175609192-175609214 TAGTGGGAAGAAGAGAAAGAAGG + Intronic
917618247 1:176768223-176768245 CAGGGGGAGGTGGGAGAAGAAGG - Intronic
917678374 1:177341252-177341274 CGTTGGGAAGGGGAGGAAGAAGG - Intergenic
918106416 1:181419199-181419221 CAGGGGGAAGAGGGAGAAGATGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919543428 1:198880278-198880300 AAGTGAGTAGAGGGAGAAGAAGG + Intergenic
919862943 1:201754321-201754343 AGGTGGGCAGAGGAGGAAGAAGG + Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920235186 1:204498276-204498298 CAGTGGGTAGAGGGGAATGCAGG + Intergenic
920430724 1:205917227-205917249 CAGGGCGAAGAGGGGAAGGATGG - Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920766553 1:208839181-208839203 CATTAGGAAGATGGGGAAGGCGG + Intergenic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
920940458 1:210477339-210477361 CAGTGGGAAGAAGGCAGAGAAGG - Intronic
921032520 1:211345852-211345874 GGATGGGAAGAGTGGGAAGAGGG - Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
921279315 1:213549965-213549987 CAGTGGGGAGAGGGGCATCAGGG + Intergenic
921363461 1:214351923-214351945 AAATGGGAAGAGGGAGAGGAAGG - Exonic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921618373 1:217298633-217298655 CAGTGGGCTGAGGTGGAGGACGG + Intergenic
921666265 1:217875473-217875495 CAGTGTGAAGATGGGCTAGAGGG + Intergenic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922095441 1:222439461-222439483 CACTGGGAATGGGGGGACGAGGG - Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922394225 1:225179508-225179530 AAGTTGGAAGGTGGGGAAGATGG - Intronic
922455449 1:225770442-225770464 CAGGGGGAAGAGGGGTGTGATGG - Intergenic
922533945 1:226365922-226365944 CAGAAGGAAGTGGGGGAAGAAGG + Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923082153 1:230668262-230668284 GAAAGGGGAGAGGGGGAAGAGGG + Intronic
923273719 1:232379283-232379305 CACTGGGGAGAGGGGGTAGCGGG + Intergenic
923461843 1:234215017-234215039 CAGTTGGTAGAGGCGGGAGAGGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923482417 1:234397397-234397419 GATGGGGAGGAGGGGGAAGAGGG + Intronic
923482422 1:234397406-234397428 GAGGGGGAAGAGGGGGGAGGAGG + Intronic
923482427 1:234397416-234397438 AGGGGGGAGGAGGGGGAAGAGGG + Intronic
923482432 1:234397425-234397447 GAGGGGGAAGAGGGGGGAGGAGG + Intronic
923482436 1:234397435-234397457 AGGGGGGAGGAGGGGGAAGATGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923482572 1:234397724-234397746 GAGAGGGAGGAGGGAGAAGAGGG + Intronic
923482581 1:234397740-234397762 AAGAGGGGGGAGGGGGAAGAGGG + Intronic
923482586 1:234397749-234397771 GAGGGGGAAGAGGGGGAGGAGGG + Intronic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924016674 1:239733311-239733333 TAGTTGAAAGAGGGGGAAGAAGG + Intronic
924064298 1:240207707-240207729 CTCCGGGAAGAGGGGGAGGAAGG - Exonic
924064350 1:240207839-240207861 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924064404 1:240207971-240207993 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924064498 1:240208202-240208224 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924167188 1:241296179-241296201 GAGGAGGAAGAAGGGGAAGAAGG + Intronic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
924448479 1:244156294-244156316 CAGTGGGTAGAGGGTGAGGGAGG - Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1064086457 10:12349459-12349481 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065667207 10:28075093-28075115 GAGCAGGAAGAAGGGGAAGAGGG + Intronic
1065708735 10:28495217-28495239 CAGAGGGAAGGAGGGAAAGAAGG + Intergenic
1065856642 10:29836496-29836518 CAATGGGAAGAGGAGGAACCTGG - Intergenic
1066276614 10:33875196-33875218 GAGTGGGAGGAAGGGGAAGAGGG + Intergenic
1066306230 10:34144727-34144749 TATTGGGAAGATGTGGAAGATGG - Intronic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067095798 10:43298750-43298772 CAGTGGGAGGTGGGGGAACCAGG - Intergenic
1067181203 10:43987207-43987229 CAATGGGAAGAAGGGAAGGAGGG + Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067216152 10:44305601-44305623 CAGAGGCAGGAAGGGGAAGAGGG + Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067578271 10:47421170-47421192 CTGTGGGAGGAGGGGGCAGCCGG + Intergenic
1067807912 10:49405909-49405931 GAGAAGGAAAAGGGGGAAGAGGG - Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069265709 10:66454815-66454837 GAGGGGGAGGAGGGGGAGGAGGG + Intronic
1069584323 10:69587539-69587561 GACTGGGAAGAGGGAGAAGTTGG - Intergenic
1069943820 10:71972802-71972824 CAAGGGGAAAAGGGGGAAGGAGG - Intronic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070263030 10:74876205-74876227 GGGTGGGGAGTGGGGGAAGAAGG - Intronic
1070383752 10:75904972-75904994 CAGTGGAAGGAGGGGAGAGAGGG + Intronic
1070523326 10:77274086-77274108 CAGTGGCAAGAGGGAAGAGAGGG - Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071877767 10:89861338-89861360 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072181442 10:92985068-92985090 AAGGAGGAAGAGGGAGAAGAAGG - Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072242635 10:93511458-93511480 CAGTGAGAAGAGGTGGCATAAGG + Intronic
1072394475 10:95024685-95024707 GAGTGGGGGGAGGGGGAAGGGGG + Intergenic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072790243 10:98312515-98312537 AAGTGGGAAGAGGGAGAAACAGG - Intergenic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1073137914 10:101229903-101229925 CAGTGGGGTGAGGGGCAAGAGGG - Intergenic
1073354866 10:102845786-102845808 CATTGGAAAGACTGGGAAGATGG + Intergenic
1073371645 10:102995153-102995175 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371652 10:102995171-102995193 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073473823 10:103740057-103740079 TAGTGGGCAGAGGAGGAAGGAGG + Intronic
1073580045 10:104656990-104657012 AAGTTAGAAGATGGGGAAGAAGG - Intronic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074737011 10:116445944-116445966 GGGTAGGAAGATGGGGAAGAAGG + Intronic
1074781767 10:116807361-116807383 CAGGGGTAAGAGGGGAAAGCAGG - Intergenic
1074874013 10:117600444-117600466 TAATGGGAAGAGGGCGAATATGG + Intergenic
1074921528 10:118019353-118019375 AGGAGGGAAGAGGAGGAAGAGGG + Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1075851962 10:125596361-125596383 GAAAGGGAAGAGGAGGAAGAGGG + Intronic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076682114 10:132178345-132178367 AAGGGGGTAGAGGAGGAAGAGGG + Intronic
1076718180 10:132378421-132378443 CAGGGAGAAGAGGGAGAACAGGG - Exonic
1076770521 10:132660767-132660789 CAGTCAGAACTGGGGGAAGATGG + Intronic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077338408 11:2015576-2015598 GGGAGGGAAGAGGGGGAAGACGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077509728 11:2951790-2951812 CAGTTTGAAGAAGGTGAAGAAGG - Exonic
1077531316 11:3096963-3096985 AAGAGGAAAGAGGGGGAAGGTGG + Intronic
1077531325 11:3096995-3097017 AAGAGGAAAGAGGGGGAAGACGG + Intronic
1077531350 11:3097084-3097106 AAGAGGAAAGAGGGGGAAGATGG + Intronic
1077531359 11:3097116-3097138 GAGAGGAAAGAAGGGGAAGATGG + Intronic
1077587583 11:3465745-3465767 CAGTGGGATGAGGAAGAAGCAGG - Intergenic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078593369 11:12665212-12665234 GAGGAGGAAGAGGAGGAAGAAGG + Intergenic
1078609337 11:12806521-12806543 CCCTGGGAGGAGGAGGAAGATGG + Intronic
1078697025 11:13644585-13644607 CAGGAGGAAGAGGGGAAAGGGGG + Intergenic
1078741073 11:14066822-14066844 GACTGAGAAGAGGGAGAAGAGGG - Intronic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079027948 11:16963572-16963594 GACTGGGGAGAGGGGCAAGAGGG + Intronic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079173751 11:18120468-18120490 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1079253110 11:18802129-18802151 CACTGAAAAGAGGGGAAAGAGGG - Intergenic
1079272592 11:19002778-19002800 GAGTGGGGAGAGTGGGAGGAGGG - Intergenic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079755097 11:24248770-24248792 CAGTGGGATGAGGGGAAACTGGG + Intergenic
1080091962 11:28359075-28359097 GAGTAGGGAGAGGGTGAAGAGGG - Intergenic
1080102556 11:28476207-28476229 CAGTGTGAAGAGGGGGACAATGG - Intergenic
1080127530 11:28754463-28754485 CAGAGGGAAGAAGGGAAGGAAGG + Intergenic
1080296798 11:30739064-30739086 CAGTGTGAAGAGGGGTTAGCTGG + Intergenic
1080300326 11:30777040-30777062 CAAAGGGAAAAGGGGGAAAATGG - Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080685938 11:34514777-34514799 CAGTGGCAAAAGGAGGAAGTGGG + Intergenic
1081011417 11:37817434-37817456 AAATGGGAAAAAGGGGAAGAAGG + Intergenic
1081433928 11:43006126-43006148 AAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1081477202 11:43446214-43446236 CAGAGGGCAGAGGGGGCACAGGG - Intronic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1081710742 11:45213868-45213890 TAGTGGGAAGAGGAGGCAGGGGG + Intronic
1081722958 11:45303562-45303584 GAGTGGGAAGAAGAGGAAGCTGG + Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081795735 11:45818109-45818131 CATGGGGAAGAGTGGAAAGAGGG + Intergenic
1081908860 11:46687237-46687259 CAGTGGGAAGAGGGTTCAGAAGG + Intronic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1083250540 11:61463999-61464021 GAGAGGGAAGAGGGGAAGGAAGG - Intronic
1083269562 11:61564939-61564961 GAGTGGGAAGAGGAGGACAATGG + Intronic
1083269626 11:61565245-61565267 CAGATGGAAATGGGGGAAGATGG + Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083725024 11:64623416-64623438 CTGAGGGAAGAGGATGAAGAGGG - Intronic
1083962226 11:66020860-66020882 CAAGGTGAAGAGGGTGAAGATGG + Exonic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1083996290 11:66274718-66274740 AAGAGGGGAGAGGGGGAAGAGGG - Intronic
1084152951 11:67299723-67299745 CTGGGGGAAGAGGGGTCAGACGG - Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084338578 11:68476448-68476470 CCGTGGGGAGAGGGGGGAGGGGG + Intronic
1084584351 11:70048669-70048691 GAGTGGGGAGAGGGGGAGAAGGG - Intergenic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084861077 11:72018614-72018636 CATAGGGAAGAGGAGGAATATGG + Intronic
1084908634 11:72369403-72369425 GTGGGGGAGGAGGGGGAAGAGGG - Intronic
1085034565 11:73292286-73292308 AAGAGGGAAGCGGGGGGAGAAGG + Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085297457 11:75439122-75439144 CCGTGGGAACAGGGAGCAGAGGG + Intronic
1085407099 11:76269883-76269905 CTGGGGGAAGATGGGGAAGTGGG - Intergenic
1085510064 11:77083655-77083677 CAGTGGGAAGAGGAGTGAGGGGG - Intronic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086430346 11:86731551-86731573 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
1086602840 11:88656268-88656290 CAGTGAGAAGAGGGAGAAATTGG - Intronic
1086737885 11:90329831-90329853 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1088528904 11:110786718-110786740 CAGGAGCAAGAGGGGGAGGAAGG - Intergenic
1088542911 11:110931696-110931718 AAATGGGAGGAGGGGAAAGAAGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088807442 11:113365376-113365398 GAGTGGGAGGGAGGGGAAGAAGG - Intronic
1088950189 11:114560781-114560803 CAGGGGTTAGAGGGGAAAGAAGG - Intergenic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089071164 11:115700700-115700722 CAGAGGGAAGAACGGGAGGAGGG + Intergenic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089305601 11:117524467-117524489 CAGTGGGATGAGGAGGGTGATGG - Intronic
1089490774 11:118882489-118882511 AGGTGTGAAGAGGGGAAAGAGGG + Intergenic
1089558516 11:119330429-119330451 GAGGGGGAAGAAGGGAAAGAAGG - Intergenic
1089558518 11:119330438-119330460 GAGAGAGAGGAGGGGGAAGAAGG - Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1089793674 11:120963061-120963083 CAGTGGGAAGAAGGATGAGATGG + Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1089928859 11:122288140-122288162 CAGTGAGAGGAGGGGGACGTAGG + Intergenic
1090068765 11:123525943-123525965 CAGCTGGGAGAGGGGGAAGAAGG + Exonic
1090502961 11:127279711-127279733 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1091108220 11:132942848-132942870 AGGAGGGAAGAGGGGGCAGAAGG - Intronic
1091351106 11:134895255-134895277 GGGTGGGATGAGGGAGAAGAGGG - Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1202821392 11_KI270721v1_random:70758-70780 GGGAGGGAAGAGGGGGAAGACGG - Intergenic
1091418959 12:318041-318063 CAGAAGGTAGAGTGGGAAGAAGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091603128 12:1929918-1929940 GAGGGGGAGGAGGAGGAAGAGGG + Intergenic
1092005290 12:5064231-5064253 CATTGGGAAGAGAAAGAAGAAGG + Intergenic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093094539 12:14957831-14957853 GAGAAGGAAGAGGGGAAAGAGGG + Intronic
1093569065 12:20644853-20644875 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1093569070 12:20644862-20644884 GAAGAGGAAGAGGGGGAAGAGGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093829008 12:23732187-23732209 CAGTAGGAAGAAGGAGAAAAGGG + Intronic
1094074442 12:26457366-26457388 GAGAGGGGAGATGGGGAAGAAGG + Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094191822 12:27705887-27705909 CAGTTGGTAGAGGTGGGAGATGG - Intergenic
1094192089 12:27708281-27708303 CACTGGGAAGAGGGCCAAGTGGG - Intergenic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094497973 12:31001061-31001083 CAGTGTGAAGAGTGGTCAGAGGG - Intergenic
1094837744 12:34330084-34330106 AAGTGGCAAGAGGGCCAAGAAGG - Intergenic
1095153429 12:38823051-38823073 GAGAAGGAAGAGGAGGAAGAGGG - Intronic
1095520746 12:43062050-43062072 GAGTGGAAAGAGGGGGTAGAAGG - Intergenic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1095585299 12:43843172-43843194 GAAAGGGAAGAGGGGGAAGAGGG - Intronic
1096468759 12:51863687-51863709 CAGAGGGATGAGGGGCAAGGCGG + Intergenic
1096489309 12:52005114-52005136 AGGTGGGAGGAGGGAGAAGAAGG + Intergenic
1096578456 12:52569447-52569469 CAGTGGGAGGAGGAGACAGAGGG + Intronic
1096692996 12:53332738-53332760 AAGGGGGAGGAGGAGGAAGAAGG + Intronic
1096789790 12:54037471-54037493 GAGTGGGAAGAGGGGGGACACGG + Intronic
1096789804 12:54037614-54037636 CAGGGTGGAGAGGGGGGAGAGGG - Intronic
1097032876 12:56102115-56102137 GAGAGGGAATAGGGAGAAGACGG - Exonic
1097054264 12:56240466-56240488 CGGTGGGGAGAGGGGGGAGGGGG + Exonic
1097127290 12:56784687-56784709 CCGTGGGGAGAGGGAGACGAGGG + Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098275069 12:68804807-68804829 CAGTGGGAAGGAGGAGAAGGGGG + Intergenic
1098300742 12:69051876-69051898 CAGTGGGAAAAGGGTGGAAAAGG + Intergenic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098655843 12:73028284-73028306 CAGGAGGAAGAGGGTGAAGAGGG - Intergenic
1098905687 12:76159908-76159930 TAGTAGGAGGAGGGGGATGAAGG - Intergenic
1099449722 12:82794334-82794356 GAGTTGGTAGATGGGGAAGAGGG - Intronic
1099477899 12:83130113-83130135 GAGTGGGAAGAGTGGAAATAGGG - Intronic
1099617172 12:84950811-84950833 GAGTGGGAGGAGGGTGAGGATGG + Intergenic
1099758366 12:86885702-86885724 CAGAGAGAAGAGGGGAAAGTTGG - Intergenic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100236445 12:92666535-92666557 GACTGGGGAGAGGGGAAAGAGGG - Intergenic
1100451806 12:94713731-94713753 CAGTGGGAAGTGTGTGGAGAAGG + Intergenic
1100550679 12:95644186-95644208 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1100550684 12:95644195-95644217 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1100553151 12:95666269-95666291 CAGGGGGAAGAGAGGGGATAAGG + Intronic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101535964 12:105616737-105616759 CAGCAGGAAGAGGAAGAAGAGGG - Intergenic
1101794118 12:107957092-107957114 GAAGGGGAAGAAGGGGAAGAAGG - Intergenic
1101794121 12:107957101-107957123 GAAGGGGAAGAAGGGGAAGAAGG - Intergenic
1101893718 12:108738562-108738584 TAGTGAGAAGTGGGGGGAGAGGG - Intergenic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102453499 12:113057494-113057516 CTGGGGGACGAGGGGGACGAGGG - Intronic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1103123844 12:118403823-118403845 CAGAGGTAAGAGGGGTCAGAGGG - Intronic
1103239781 12:119403590-119403612 CAGGGGGAAGATGGGGCTGAGGG - Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103741858 12:123096510-123096532 CAGTGGGAAGATGGGGAGGGGGG + Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104088400 12:125494819-125494841 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1104088444 12:125494930-125494952 TTCAGGGAAGAGGGGGAAGAGGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104644278 12:130486062-130486084 CAGTGGCTGGAGGGGGATGAGGG - Intronic
1105315635 13:19259342-19259364 CATTGGGAATTTGGGGAAGATGG - Intergenic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1105609811 13:21958408-21958430 GAGTGGAAAGAAGGGGAAGAGGG - Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1106559762 13:30838130-30838152 CAGTGACAAGAGTGGAAAGAAGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106713546 13:32364505-32364527 TAGAGGGAAGATGGGGAAGAGGG - Intronic
1106742413 13:32660105-32660127 GGGTGGGAAGAGGAGCAAGATGG - Intronic
1106843674 13:33713517-33713539 AAGTGGGAAGAAGGAGAAGGAGG - Intergenic
1106896657 13:34310121-34310143 CAGTGGGAAGAACAGGTAGAAGG + Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107662669 13:42655569-42655591 AAGTGGCATGAGGTGGAAGATGG - Intergenic
1107692298 13:42965804-42965826 CCGTGGGGAGAGGGAGACGAGGG - Intronic
1107850421 13:44566916-44566938 AAGTGGGATGTGGGGGGAGAAGG + Intronic
1107932302 13:45316289-45316311 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109237266 13:59839843-59839865 CAGTGAGTAGATGGGAAAGATGG + Intronic
1109316949 13:60760976-60760998 GAGTGGGGAGATTGGGAAGAGGG - Intergenic
1109343213 13:61088266-61088288 CAGTTGGAAGAGGGCCAAGTGGG - Intergenic
1109759720 13:66812066-66812088 TAGGGGGAAGAGTGGGAAGGGGG - Intronic
1110428152 13:75392601-75392623 GAGGAGGAGGAGGGGGAAGAAGG - Intronic
1110600780 13:77370584-77370606 GAGAGGGAAGTGGGGGAGGAGGG + Intergenic
1110867632 13:80414530-80414552 GATTGGGAGGAGGGTGAAGATGG + Intergenic
1111135412 13:84036274-84036296 CACTTGGAAGAGGGCCAAGAGGG + Intergenic
1111476838 13:88761081-88761103 CAGTTGGAAGAGGGCCAAGCAGG + Intergenic
1111639159 13:90946353-90946375 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111830364 13:93321958-93321980 GAGGTGGAGGAGGGGGAAGAAGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1111988917 13:95095534-95095556 TAGGGGGAAGAGTGGGAGGAGGG + Intronic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1112379953 13:98879254-98879276 CAGTGGGAACCAGGGGAAGCAGG + Intronic
1112626569 13:101111459-101111481 CAGAAGGAGGAGGGGCAAGAGGG - Intronic
1112733135 13:102389107-102389129 AAAGGGGAAGAAGGGGAAGAAGG - Intronic
1112922942 13:104637646-104637668 AAGAGGGAAGAGGGGTAAAAGGG + Intergenic
1112949742 13:104977981-104978003 GACTGGGAAGAGAGGGAAAAAGG - Intergenic
1113146056 13:107208877-107208899 GAGGGGGAGGAGGGGGAGGAAGG - Intronic
1113193818 13:107782039-107782061 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1113229763 13:108199738-108199760 TATTGGAAAGTGGGGGAAGAGGG - Intergenic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113430587 13:110246926-110246948 CACTTGGAAGACGGGGAATATGG + Intronic
1113512413 13:110866762-110866784 GCGTGGGGAGAGGGTGAAGAAGG - Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1115157962 14:30361631-30361653 TTGGAGGAAGAGGGGGAAGAAGG + Intergenic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116416627 14:44685350-44685372 CTGAGGGAAGAAGGGAAAGAAGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1117225341 14:53652831-53652853 TAGTAAGAAGAAGGGGAAGATGG - Intergenic
1117442698 14:55774838-55774860 CAGTGGGGAGAGGATGAGGAGGG - Intergenic
1117656920 14:57964783-57964805 CATTGGTGAGAGGGGGCAGAGGG + Intronic
1117761661 14:59035422-59035444 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1117834344 14:59786633-59786655 AAGAGGGAGGATGGGGAAGAAGG + Intronic
1118548577 14:66922782-66922804 TAGTAGGAGGAGGGGAAAGAGGG - Exonic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119074341 14:71621037-71621059 CAGGGGCAGGAGGGAGAAGATGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119180390 14:72601062-72601084 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1119217652 14:72881470-72881492 TAGTGGGAAGCCTGGGAAGACGG + Intronic
1119235131 14:73013304-73013326 CATTGAGAAGAGGGGCAAAATGG + Intronic
1119424413 14:74526586-74526608 GAGTGGGCAGAGGGTGAAAAAGG + Intronic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1119660256 14:76446039-76446061 GGGAGGGAAGAGGGGGAAGATGG + Intronic
1119702659 14:76765795-76765817 CAGTGGCAAGATGGGGGAGTAGG - Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1119850161 14:77861293-77861315 AAGGGGGAGGAGGAGGAAGAGGG - Intronic
1120228997 14:81822474-81822496 CAGTGGGAAGAGGTGAGGGAGGG + Intergenic
1120647236 14:87088626-87088648 AAGTGGGAAGTGGGGGAAGTTGG + Intergenic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121306975 14:92912665-92912687 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
1121406233 14:93720855-93720877 CAGTGGGGATAGGAGGGAGAAGG + Exonic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1122117512 14:99535244-99535266 CAGTGGGAAAAGCAGGGAGAGGG + Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1125542250 15:40476346-40476368 CAGAGGCGAGAGTGGGAAGAGGG - Intergenic
1125634147 15:41173067-41173089 AAGGGGAAAGTGGGGGAAGAAGG - Intergenic
1125635878 15:41188318-41188340 GAGGGGGAAGAGGAGGGAGAGGG - Intronic
1125651284 15:41320263-41320285 CCGTGGGGAGAGGAGGGAGAGGG - Intronic
1125896508 15:43307290-43307312 GAGTTTGAAGAGGGGGCAGAAGG - Intergenic
1125964880 15:43866053-43866075 CATTGGGCAGAGGGTAAAGACGG - Intronic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1126695217 15:51320265-51320287 CACTGGGAAGAGGGAGATCAAGG + Intronic
1126785394 15:52174450-52174472 CTGTGGGAGGAAGGGGAAAATGG + Intronic
1126859095 15:52866821-52866843 CAGTGGGAAGAGCCGGATGAAGG - Intergenic
1126980559 15:54238021-54238043 CAGCTGGAAGGGGAGGAAGATGG - Intronic
1127128303 15:55835175-55835197 CAGTGGGTTGAGGGGTTAGATGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128250806 15:66163146-66163168 CAGAGGGCAGAGGGGGAATCTGG + Intronic
1128524304 15:68402085-68402107 CAGGGGCCAGAGTGGGAAGAGGG + Intronic
1128581320 15:68812218-68812240 CAGTTGGAAGTGGCGGAAGCAGG + Intronic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1129149838 15:73681661-73681683 CAGTGGGAAGTGGGGGGAAGTGG + Intergenic
1129161081 15:73748297-73748319 CAGCAGGCAGAGGAGGAAGATGG + Intronic
1129665312 15:77576322-77576344 GAGGAGGAGGAGGGGGAAGAGGG + Intergenic
1129712362 15:77826785-77826807 GAATGGGGAGAGGGGGCAGATGG - Intergenic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130241513 15:82197698-82197720 TAGTTGGAAGAGGGGTAGGAGGG + Intronic
1130658783 15:85813490-85813512 TGGTGGAAAGAGTGGGAAGAGGG - Intergenic
1130661974 15:85837916-85837938 CAGTGGGGAGGTGGGGAAGGTGG - Intergenic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1130671662 15:85918267-85918289 CAGAAGGCAGAGGGGTAAGAGGG - Intergenic
1130721016 15:86386078-86386100 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1130775003 15:86969749-86969771 AAGTGGGAAGAAGGAGAAAATGG + Intronic
1130959805 15:88652342-88652364 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131175135 15:90204487-90204509 CAGTAGGGAGAGGAGGATGAGGG + Intronic
1131565854 15:93484737-93484759 CAGGTGGAAGATGGGAAAGATGG - Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131912246 15:97220220-97220242 CAGAGGGGAGCAGGGGAAGAAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132020413 15:98356541-98356563 GAGCGGGAAGAGAGGGAGGAAGG + Intergenic
1132029291 15:98427301-98427323 AAGAGGGAAGAGAGGGAACAAGG - Intergenic
1132294136 15:100722973-100722995 CCCTGGGTAGAGGGAGAAGAGGG - Intergenic
1132638467 16:965779-965801 AGGTGGGTAGAGGGGAAAGAAGG + Intronic
1132714494 16:1284021-1284043 CAGTGGGAAGAGGTGGGTCACGG - Intergenic
1133742298 16:8660827-8660849 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134678840 16:16109723-16109745 CACTGGGAAGATGGGTGAGATGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1134854473 16:17506820-17506842 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
1135110434 16:19686785-19686807 AAGTGGGAAAAGGGGTGAGAAGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135665850 16:24335005-24335027 CACTGGGAAGAGGGTTAACAGGG - Intronic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135887424 16:26323380-26323402 CAGCAGGGAGCGGGGGAAGAGGG + Intergenic
1136036761 16:27546368-27546390 CGGTAGTAAGAGGGGAAAGAAGG - Intronic
1136102196 16:28004331-28004353 CAGTGGCTGGAGGGGGATGAGGG + Intronic
1136641443 16:31568904-31568926 CGCTGGGAGGAGGAGGAAGAAGG - Intergenic
1137380258 16:47991828-47991850 CATTGGGAAAAGGTGGGAGATGG + Intergenic
1137420191 16:48326812-48326834 CTGTGGGAAGAGGGAGGAAAGGG - Intronic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137557076 16:49477335-49477357 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138150183 16:54649685-54649707 CAGAGGAAAAAGGGGGCAGATGG + Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138271724 16:55700341-55700363 GAGGGGGCTGAGGGGGAAGACGG + Intronic
1138358574 16:56406077-56406099 GAGGGGGGAGAGGGGGGAGAGGG + Intronic
1138527595 16:57618000-57618022 CATGGGGAAGAGGGGCAAGAGGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138637929 16:58357877-58357899 CAGGGGGGAGAGTGTGAAGAGGG - Intronic
1138672834 16:58629557-58629579 AAGTGGGACGAGGCGGGAGAGGG - Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1138924239 16:61571252-61571274 CAGTGGGGAGAGGGAGGAAATGG - Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139602953 16:67997923-67997945 CAGTGGGCAGAGTGGAAACAAGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140276385 16:73512569-73512591 CAGTTGGAAAAGGAGGCAGATGG + Intergenic
1140333074 16:74076533-74076555 CAGTGGGAGGGAGGGAAAGAAGG - Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140400320 16:74666062-74666084 GAGGGGGAAGAGGAGGGAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140459708 16:75129927-75129949 CACTTGGAAGAGGGCCAAGAGGG + Intergenic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1141168796 16:81678252-81678274 CTGGGGGAAGAGGCGGGAGAGGG - Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141703628 16:85653308-85653330 AAGTGGGAGGAGGAGGAGGAGGG - Intronic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142781624 17:2185746-2185768 TAGTGAGAAGACGGGGACGAGGG + Intronic
1143026960 17:3946725-3946747 CAGTGGGCAGATGTGGAAGCAGG + Intronic
1143391328 17:6560950-6560972 GAGGAGGAAGAGGAGGAAGAGGG - Intergenic
1143646761 17:8235238-8235260 CAGTGGGAGGGGGGACAAGAAGG - Exonic
1144009266 17:11130515-11130537 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144105390 17:11980157-11980179 AATTGGGCAGAGGGGGAAGTGGG + Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144202775 17:12956227-12956249 CATTGGGATGAGGGGAAAGGAGG + Intronic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1144420918 17:15097818-15097840 GAGGGGGAAGAGGGGGCTGATGG - Intergenic
1144537063 17:16100911-16100933 CAGTGGGATGTGGTAGAAGAAGG - Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144695670 17:17302443-17302465 GAGTGGGAGGAGGGTGAGGATGG + Intergenic
1144828328 17:18118836-18118858 GAAAGGGAAGAAGGGGAAGAAGG + Exonic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145829897 17:27907459-27907481 CAGAGGAAAGAGGGAGAAGATGG + Intergenic
1146505516 17:33401317-33401339 GAGAGGGAAGAGGGGGAGAAAGG - Intronic
1146575778 17:33989918-33989940 CAGTGGGAAGAAGGGGAAAGAGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1147053975 17:37819707-37819729 AAGGAGGAAGAGGGGGAAGGAGG - Intergenic
1147161637 17:38572379-38572401 CTGTGGGACGCTGGGGAAGAGGG + Intronic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147250451 17:39150209-39150231 CAGTGGGAAGTATGGGCAGAGGG - Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1148029374 17:44608969-44608991 CAGTGGGAAGGGGTGGCAAAGGG + Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148478750 17:47946295-47946317 CAGGGGGAAGAGTTAGAAGAAGG - Intronic
1148560377 17:48602549-48602571 CAGTGGGAAATTGGGGATGATGG + Intronic
1148695486 17:49555852-49555874 CAGTGGGAAGGGGGCTGAGAGGG - Intergenic
1148745138 17:49913903-49913925 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1148794961 17:50192533-50192555 AGGTGGGAAATGGGGGAAGAAGG + Intronic
1149052967 17:52328792-52328814 GAGGAAGAAGAGGGGGAAGAGGG - Intergenic
1149180276 17:53928079-53928101 TAGTGGGTTGAGGGGGAAGTGGG - Intergenic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1149914066 17:60592271-60592293 AAGGGGGAAGAGGGGGTGGAGGG + Intergenic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1151141157 17:71993361-71993383 CAGTGGGAAGAGGCTGCAGGGGG - Intergenic
1151190414 17:72393921-72393943 TAGAGGGAAGAGGGGAAGGAGGG + Intergenic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151412581 17:73941063-73941085 CAATGGGAAGAGGGGGAAAGGGG + Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151434572 17:74086976-74086998 CATTGGGAAGAGGGGGATGCTGG - Intergenic
1151564778 17:74892028-74892050 AACTGGGAAGGGGTGGAAGAAGG + Intronic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1152252184 17:79218006-79218028 GAGTGGGAAGTCGGGGTAGAGGG + Intronic
1152297725 17:79478042-79478064 CAGCGGGGAGAGGGGGATCATGG - Intronic
1152334139 17:79690721-79690743 CAGTGGGATGACGAGGAGGATGG + Intergenic
1152558007 17:81064138-81064160 GAATGAGAAGAGGAGGAAGAAGG - Intronic
1152640130 17:81445833-81445855 CATTGGGAGGACTGGGAAGAGGG - Intronic
1152790861 17:82278750-82278772 AAGTGGGAAGAGGGGAGAAAGGG + Intergenic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153237263 18:3000082-3000104 AAGGAGGAAGAGGGGAAAGAGGG + Intronic
1153448157 18:5196806-5196828 CAGCGGGACGAGGGCGAGGAAGG + Intronic
1153474018 18:5477360-5477382 CAGTGGAATGAAGGGGGAGAGGG + Intronic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1153765577 18:8371731-8371753 CAGCAGAAAGAGGGGGAATAAGG - Intronic
1153963125 18:10156999-10157021 CAGAGGGCAGAAGGGCAAGAGGG - Intergenic
1154318373 18:13324521-13324543 CAGTGGCAGAACGGGGAAGAGGG + Intronic
1155066561 18:22273834-22273856 AGGAGGGAAGAGGGGGAGGAGGG - Intergenic
1155484929 18:26331124-26331146 CACTGGGAAGAGCAGGAAGGTGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155774954 18:29749747-29749769 CGCTGGGAAGAGGGGGCATAGGG - Intergenic
1155956280 18:31959515-31959537 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
1156206052 18:34887073-34887095 CATTGGGAAGAGGCAGAAGGTGG + Intronic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156463238 18:37333353-37333375 AAGGGAGAGGAGGGGGAAGAGGG - Intronic
1156463248 18:37333380-37333402 AAATAGGAAGAGGGGAAAGAGGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157279364 18:46335570-46335592 GAGTGGGGAGAGGGGGAGGAGGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157451988 18:47795711-47795733 AAGTACGATGAGGGGGAAGATGG + Intergenic
1157482538 18:48064764-48064786 CAATAGGAACAGGGAGAAGAAGG + Intronic
1157826109 18:50813846-50813868 GGGTGGGAGGAGGGTGAAGATGG + Intronic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158505608 18:58044197-58044219 CGGTGGGAGGAGGCGGAGGAGGG + Intergenic
1158581896 18:58691163-58691185 TAGTGGGGAGAGGGGACAGAAGG - Intronic
1158610501 18:58935474-58935496 AGGGGGGAAGAGGGGGGAGAAGG - Intronic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1158963762 18:62606596-62606618 AAGCGGGAAGGAGGGGAAGAGGG - Intergenic
1159520724 18:69518283-69518305 GAGAAGGAAGAGGAGGAAGAAGG - Intronic
1159915389 18:74183153-74183175 GAGCGGGAAGAGGGAGAGGAGGG - Intergenic
1160175672 18:76592248-76592270 GAGGGGGATGAGGGGGATGAGGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160475116 18:79177182-79177204 GAGGCGGAAGAGGGGGAAGGGGG - Intronic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161022239 19:2015786-2015808 TAGGGGGAGGAGGGGGAGGAGGG + Intronic
1161253100 19:3291753-3291775 GAGAGGGAGGAGGGGGAACATGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161370632 19:3908929-3908951 GAGCGGGAAGAGGAGGAGGAAGG - Intronic
1161610191 19:5238056-5238078 GGGAGGGAAGAGGGGGAAGCAGG + Intronic
1161619213 19:5289585-5289607 CAGAGGGAGGAGGGGGAGAAAGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161684817 19:5697520-5697542 GAGGGAGGAGAGGGGGAAGAGGG + Intronic
1161684819 19:5697529-5697551 GAGGGGGAAGAGGGAGGAGATGG + Intronic
1161803496 19:6429334-6429356 AAGGGGGAAGAGGGAGAGGAGGG + Intronic
1162044690 19:7990801-7990823 TAGAGGGAAGAGGAGGAAGAGGG + Intronic
1162059432 19:8085850-8085872 CAGAGGGAAGAGGGGCAGCAGGG + Intronic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1162263306 19:9549994-9550016 AAGTGGGATGAGGGGCAACATGG - Intergenic
1162550755 19:11357090-11357112 GGCTGGGAAGAGGGGGAAGGAGG + Intronic
1162661837 19:12175559-12175581 GAGTGGGAATAGGGGGCATAAGG - Intronic
1162717143 19:12641347-12641369 CAGGGGGAAGGGGAGGTAGAGGG - Intergenic
1162727572 19:12699314-12699336 CAGGGGGAAGAGGGTGAGGAGGG + Exonic
1163566472 19:18054869-18054891 CAGAGGGCAGAGTTGGAAGAAGG + Intergenic
1163686652 19:18715658-18715680 CACTGAGAAGCAGGGGAAGAGGG - Intronic
1163771741 19:19195279-19195301 GAGTGGGGAGAGGGGAAAGGAGG - Intronic
1163841502 19:19613708-19613730 GAGTTGGGAAAGGGGGAAGATGG - Intronic
1164441378 19:28282870-28282892 CAGTGGGAAGAAGAGGATGGTGG - Intergenic
1164567662 19:29339479-29339501 GAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164766567 19:30777075-30777097 GGATGGGAAGAGGGGCAAGAGGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1164868676 19:31625758-31625780 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1164903713 19:31949630-31949652 GAATGGGAAGAGGATGAAGAAGG - Intergenic
1164957809 19:32402187-32402209 CAGGAGGAAGAGGAAGAAGAAGG + Intergenic
1164972184 19:32542014-32542036 CAGTGGGAGGAGGGTAAGGATGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165137655 19:33680039-33680061 GAGTGGGAAGAAGTGGAATAGGG - Intronic
1165157000 19:33795371-33795393 CAGTGGGAGGAAGGTGAAGTGGG - Intergenic
1165354156 19:35293550-35293572 CCGTGGGAAGAGGGCGGTGAAGG + Intronic
1165860788 19:38908158-38908180 CAGAGGGAAGGGGTGGAGGAGGG + Intronic
1166184220 19:41128847-41128869 GAGAGGGAGGAGGGGGAGGAGGG + Intergenic
1166219285 19:41354360-41354382 CAGTGGGAGGAGGGGGCAACAGG + Intronic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1166331703 19:42081485-42081507 CAGTGCTAAGAGGTGGAAGGTGG - Exonic
1166563903 19:43751692-43751714 CACTGGGAGGAAGGGGCAGAAGG - Intronic
1166564593 19:43755727-43755749 CAGTGGGCAGAGTGGGTGGATGG + Intergenic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166587570 19:43963899-43963921 CACTCGGAAGAGTGGGAAGTAGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166985723 19:46659285-46659307 CAGAGGGCTGAGGGGGAGGAGGG + Intronic
1167191248 19:47991609-47991631 AGGAGGGAAGAGGAGGAAGAGGG - Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167382383 19:49146134-49146156 TAGTAGGAAGAGGGGAGAGAAGG - Intronic
1167707975 19:51093118-51093140 CAGGTGGAAGATGGGGAAGCCGG + Intergenic
1167992736 19:53374210-53374232 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
925047018 2:780291-780313 CACTGGGAAAAGGGGAAAAAGGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925786510 2:7436370-7436392 CCGTGGGAACATGGGAAAGAAGG - Intergenic
925902045 2:8515818-8515840 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
925902050 2:8515827-8515849 GAGAGGGAGGAGGGGGAGGAGGG - Intergenic
926184741 2:10680306-10680328 GAGGGAGAAGAGGGAGAAGAGGG + Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926227610 2:10979338-10979360 GTGAGGGAAGAGGGTGAAGATGG + Intergenic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
926874468 2:17459258-17459280 CGGTGGGAAGAGGAAGAGGAAGG + Intergenic
927089023 2:19696403-19696425 CAGTGGGAAGTGGTGGCAGTGGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927667722 2:25043623-25043645 AAGTGGGAGGAGGGGGAGGTTGG + Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
927930385 2:27040001-27040023 AAGATGGAAGTGGGGGAAGAGGG - Intronic
927934204 2:27066591-27066613 CAGTGGTAAGAGGGGAACCAAGG + Intronic
928268286 2:29831122-29831144 GAAGGGGAAGAAGGGGAAGAAGG + Intronic
928268289 2:29831131-29831153 GAAGGGGAAGAAGGGGAAGAAGG + Intronic
928268292 2:29831140-29831162 GAAGGGGAAGAAGGGGAAGAAGG + Intronic
928402269 2:30987713-30987735 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
928467607 2:31537371-31537393 CCATGGGAGGAGGGGGAAGGAGG - Intronic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929115269 2:38438683-38438705 GAATGGCAGGAGGGGGAAGATGG - Intergenic
929251447 2:39760255-39760277 GACAGGGAAGAGGGGGAAGTTGG + Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930079557 2:47434536-47434558 CCGTGGGGAGAGGGAGAGGAGGG + Intronic
930494793 2:52127493-52127515 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
931055039 2:58460325-58460347 CATTGAGAAGAGGAAGAAGATGG - Intergenic
931340761 2:61398559-61398581 AAGCGGGAAGAGGGGAAAGTCGG + Intronic
931763894 2:65437834-65437856 CTTTGGGAGGAGGGGGAAGGAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932136768 2:69238080-69238102 AAGTGGGAAGCTGGGGATGAGGG - Intronic
932220550 2:69995734-69995756 AGGTGGGAAGAGCAGGAAGAAGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933188345 2:79303794-79303816 CAATGGGAAGTGGGGGCTGAGGG + Intronic
933643363 2:84787927-84787949 CACTGGGAAGTGGGGGAAGGAGG + Intronic
933811091 2:86033192-86033214 CAGTGACAAAAAGGGGAAGAGGG - Intronic
933837793 2:86259851-86259873 AAGTGGGAAGAGGGGAATGGGGG + Intronic
934108818 2:88722886-88722908 CAGATGGCAAAGGGGGAAGAAGG + Intronic
934653263 2:96104224-96104246 AAGGAGGAGGAGGGGGAAGAGGG - Intergenic
934666424 2:96174480-96174502 CAGTGGGAAGAGGAGGCCAAGGG - Intergenic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
935959802 2:108413739-108413761 AAGTGGGAAGAAGGGGGAAATGG + Intergenic
936521274 2:113213334-113213356 TAATGGGGAGAGGGAGAAGAGGG + Intergenic
936717537 2:115205866-115205888 GAGCTGGAAGAGGGGGAAGCAGG + Intronic
936746430 2:115582068-115582090 CACTTGGAAGAGGGGCAAGCGGG + Intronic
936859148 2:116995019-116995041 CAATGGGAAGGGGAAGAAGAGGG + Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
936960035 2:118063249-118063271 GAGTGGGAGGAGGGTGAGGATGG - Intergenic
937053404 2:118910623-118910645 GAGAGGGAAGGGGAGGAAGAGGG + Intergenic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937429108 2:121823832-121823854 CAATGAGAAGGGGAGGAAGACGG - Intergenic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937770965 2:125720758-125720780 CAGTTGGTAGAGGGGAGAGATGG + Intergenic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
937856625 2:126676738-126676760 CACTGGGAAGATGTGGCAGAGGG + Intronic
937985949 2:127638181-127638203 CAGTGGGCAGAGGAGGAGGTGGG - Intergenic
938242178 2:129751712-129751734 AAGGAGGAAGAGGGGGAAGGGGG + Intergenic
938401691 2:130998070-130998092 TAGTGGGAAGTGGTGAAAGAAGG - Intronic
938572368 2:132572227-132572249 CAGACGGAAGAAGGGGCAGAGGG - Intronic
938580042 2:132637585-132637607 CAGTAGGAAAAAGGGCAAGAAGG + Intronic
938768219 2:134478063-134478085 CAGTAGCAAGAGTGGGAACAAGG - Intronic
939308335 2:140437806-140437828 CAGTGGGAAGAAGGGGGAAAGGG + Intronic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939478948 2:142723987-142724009 CAGAGGTTAGAGGTGGAAGAAGG - Intergenic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
939822167 2:146970536-146970558 CAGGAGGAAGAGGGTGAAGAGGG + Intergenic
939834217 2:147108352-147108374 TAGTTGGAAGAGGAGGAAGCTGG - Intergenic
940191032 2:151040158-151040180 CAGTGGCAAGAGGTAGAACAAGG + Intronic
940481700 2:154240966-154240988 CAGTGGGAGGAGGCGGAATTTGG - Intronic
940552219 2:155174150-155174172 CAGTGGGAAAAGGTGGGAAAGGG - Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
941036563 2:160575340-160575362 TAGTGGGAAGGTGGGGATGATGG - Intergenic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
942450750 2:176106881-176106903 GAGGGGGAAGAGGGGGAGGAAGG - Intronic
942793176 2:179784316-179784338 TAGGGGGAAGAATGGGAAGAGGG + Intronic
942948672 2:181698108-181698130 TAGGGGGAAGAGGTGGAAAAGGG - Intergenic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943853890 2:192763543-192763565 AAGTGGGAAGAGTAGGGAGAAGG + Intergenic
943977925 2:194507838-194507860 CAGAGGAAAGAGTGGGAAGTGGG + Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945409842 2:209495230-209495252 CTGGGGGAAGAGGGGGATGTGGG + Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945522614 2:210847226-210847248 CAGTGGGATGAGGAGGAGGCTGG - Intergenic
945768523 2:214010752-214010774 CACTAGGAAGATGGGGAAGGAGG + Intronic
945988770 2:216375656-216375678 AGGTGGGAAGAGGGGGGAGGTGG + Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946395714 2:219442721-219442743 CAGTGAGGAGAAGGAGAAGATGG - Intronic
946959719 2:224971287-224971309 CAGTGGGAAGAGGGTGTGGTTGG + Intronic
947141956 2:227027479-227027501 GAGTGGGAGGAGGGGGGAGGGGG + Intronic
947360765 2:229343193-229343215 AAGTGGGAAGACGGTGTAGAAGG - Intergenic
947518566 2:230827861-230827883 CATTTGGAAGAGGGCGCAGAGGG - Intergenic
947539852 2:230968920-230968942 GAGTCGCAAGAGGGAGAAGATGG + Intergenic
947544693 2:231002554-231002576 GAGTTTGGAGAGGGGGAAGATGG + Intronic
948187228 2:236030928-236030950 AAGTGGGAAGAGGGAGAGGGAGG + Intronic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
948723017 2:239913158-239913180 CAGCTGGCAGAGGAGGAAGAAGG - Intronic
948742231 2:240055615-240055637 AAGCAGGAAGAGGAGGAAGAGGG + Intergenic
948752181 2:240139212-240139234 CAGGGGGAAGTGGGCAAAGAAGG + Exonic
948920491 2:241063925-241063947 CAGCGGGAAGAAGGGAAAGGAGG - Intronic
949025556 2:241765784-241765806 GAGTAGGAAGAGGGGGGAGAAGG + Intronic
949025753 2:241766334-241766356 GAGTAGGAAGAGGGGGGAGAAGG + Intronic
1168826898 20:820014-820036 CAGAGGGAAGAGGAAGGAGAAGG - Intergenic
1168953906 20:1820955-1820977 CATTGAGAAGATGGGGAAGCTGG - Intergenic
1169063945 20:2682151-2682173 GAAGGGGAAGAAGGGGAAGAAGG + Intergenic
1169748112 20:8963796-8963818 GAATGGGAAGGAGGGGAAGAGGG + Intronic
1170032688 20:11959300-11959322 GAGGGGGAAGAGAGAGAAGACGG + Intergenic
1170458594 20:16555734-16555756 AAAAGGGAAAAGGGGGAAGATGG + Intronic
1170489852 20:16861938-16861960 CAGTGGACAGAGGAGGAAAATGG + Intergenic
1170683506 20:18547724-18547746 CAGTGGGGAGTGGGGGTGGAGGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171062037 20:21974366-21974388 CAGTGGGAAGGATGGGAGGAGGG - Intergenic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171284346 20:23924861-23924883 GAGTGGAATGTGGGGGAAGAGGG + Intergenic
1171326511 20:24298322-24298344 CACTGGGAAGAGGCAGCAGATGG + Intergenic
1172009488 20:31838039-31838061 CAGTGGGAGGATGGGGATCAGGG + Intergenic
1172093560 20:32449776-32449798 CAGAGGGATGCGGGGGAAGAGGG + Intronic
1172104916 20:32511080-32511102 TCGTGGGAGGAGGGGGAGGAGGG - Intronic
1172157005 20:32834024-32834046 CAAGGGGAATAGGGGCAAGAAGG - Intronic
1172226127 20:33306369-33306391 CACTAGCAAGAGGGGGAACAGGG - Intronic
1172402461 20:34661345-34661367 GGGTGGGAGGAGGGTGAAGATGG - Intronic
1172477627 20:35250745-35250767 CAGGGGGAAGAGTGAGAAGGGGG + Intronic
1172486123 20:35298747-35298769 TACTGGGAGGAGGCGGAAGAGGG - Intergenic
1172716856 20:36970756-36970778 CATTTGGAAGAGGGAGAAGTGGG + Intergenic
1172758528 20:37305509-37305531 CAGTGGGTAGGGGGGTATGATGG - Intronic
1172784360 20:37456933-37456955 GGGTGGGAAGAGGGTGATGATGG - Intergenic
1172872937 20:38147085-38147107 CAGGAGGGAGATGGGGAAGAAGG + Intronic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1173005993 20:39140016-39140038 CCGGAGGAAGAAGGGGAAGAGGG - Intergenic
1173020276 20:39261394-39261416 CAGTGTGCAGAGTGGAAAGAAGG - Intergenic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173485688 20:43439366-43439388 CACAGAGAAGAGGGGGAAAAAGG - Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173865878 20:46312464-46312486 AAGCGGGAGGAGGGGGAGGAAGG - Intergenic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174267307 20:49341130-49341152 GAGAGGGAAGGGGGGGAAGGGGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174766314 20:53257132-53257154 CAAAGGGAAGAGGTGGAAGGTGG - Intronic
1175120085 20:56710598-56710620 GAAGGGGAAGAGGGGGAAGAAGG - Intergenic
1175268873 20:57719972-57719994 TAGTGGGAAGTGGGAGAGGAGGG + Intergenic
1175504613 20:59472741-59472763 CAGTGGGAAGTGGGGTAAGGGGG + Intergenic
1175543349 20:59762064-59762086 GAGAGGGAAGATGGGGAGGAGGG + Intronic
1175563849 20:59956549-59956571 TGGGGGGAAGAGTGGGAAGAGGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1176045898 20:63092444-63092466 CATTGGGATGATGGGGAAGTGGG - Intergenic
1176124210 20:63468244-63468266 CTGTGGGAAGAAGGGGAATGTGG + Intronic
1176289861 21:5038075-5038097 CAGTGGGGAGAGGGGAGAGCGGG - Intronic
1176720429 21:10388192-10388214 GAGGGAGAAGAGGGAGAAGAAGG + Intergenic
1176940168 21:14913559-14913581 CAGTGGGAGGTGGAGCAAGATGG - Intergenic
1176956064 21:15105387-15105409 AAGAGGGAAGAGGAAGAAGAGGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177259188 21:18706927-18706949 GAGGGGGAAGACGGAGAAGAGGG - Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177259193 21:18706945-18706967 AAAGGGGAAAAGGGGGAAGAGGG - Intergenic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1177797216 21:25791627-25791649 GGGTAGGAAGAGGGGGAAAATGG + Intergenic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178034217 21:28563195-28563217 CCGTGGGGAGAGGGGGACCATGG - Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178352287 21:31880868-31880890 CACTGGGCAGAGGGAGAAGCTGG + Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1179049337 21:37875393-37875415 CACTGGGAAGAAGGGGGAGGAGG - Intronic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179179819 21:39035806-39035828 CAATTGGAAGAGGGGAAGGAGGG - Intergenic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1179867390 21:44225564-44225586 CAGTGGGGAGAGGGGAGAGCGGG + Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180304720 22:11065348-11065370 CAGTGGGAGAAGGGTAAAGAGGG - Intergenic
1180762492 22:18220762-18220784 CACTGCGCAGAGGGGGCAGAGGG + Intergenic
1180773175 22:18403846-18403868 CACTGCGCAGAGGGGGCAGAGGG - Intergenic
1180804530 22:18653395-18653417 CACTGCGCAGAGGGGGCAGAGGG - Intergenic
1180806220 22:18716015-18716037 CACTGCGCAGAGGGGGCAGAGGG + Intergenic
1181026404 22:20130251-20130273 CAGTGGGAAGAAGCGGAATCAGG - Intronic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181217167 22:21341796-21341818 CACTGCGCAGAGGGGGCAGAGGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181534276 22:23533684-23533706 GAGAGGGAAGAGGGCGAAGGAGG + Intergenic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181661447 22:24352767-24352789 CACAGGGAAGAGGAAGAAGAAGG - Intronic
1181711873 22:24696215-24696237 GAGGGGGAAGAGGGGGAGGAGGG - Intergenic
1181883376 22:25999528-25999550 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1181945046 22:26510008-26510030 TTTAGGGAAGAGGGGGAAGATGG - Intronic
1182021891 22:27088648-27088670 CATTGGGAACTTGGGGAAGAGGG + Intergenic
1182027992 22:27135389-27135411 GAGTGAGAAGAAGGGGGAGAGGG + Intergenic
1182593526 22:31400143-31400165 CACTGGGAAAAGGGGGAATAAGG - Intronic
1183022031 22:35034979-35035001 CAGGGGGCAAAGGGAGAAGAGGG + Intergenic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183336911 22:37254045-37254067 TATGGGGGAGAGGGGGAAGAGGG + Intergenic
1183441565 22:37825713-37825735 CAGTTGGAAGAATGGGCAGAGGG - Intergenic
1183709165 22:39492327-39492349 CAGTGGGGAGAGGGGGCTGCAGG + Intergenic
1184059387 22:42073065-42073087 CAGTAGGAGGTGGGGGTAGAAGG - Intergenic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184212502 22:43044120-43044142 CAGCGGGGACAGGGAGAAGATGG - Intronic
1184257202 22:43294158-43294180 CAGTGGGAAAAGGGTGCAGAGGG - Intronic
1184281739 22:43441336-43441358 CAGTGGGCAGAGGGGACAGTGGG - Intronic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1185310295 22:50150547-50150569 CAGGGGGAAGCGGGGAGAGACGG + Intronic
1203235007 22_KI270731v1_random:144828-144850 CACTGCGCAGAGGGGGCAGAGGG - Intergenic
949321534 3:2816422-2816444 TAGGGGGAAGAGTGGGAAGTGGG + Intronic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949676464 3:6459945-6459967 CACTGGGAATAGGGCCAAGAGGG + Intergenic
949702589 3:6776301-6776323 CAGGGGGTAGAGGGGGAGCAGGG - Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950125745 3:10508818-10508840 CACAGGGAAGAGGGGGAAAGAGG + Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950220439 3:11191403-11191425 CTATGGGAAGAGGGGGAGGTGGG - Intronic
950483634 3:13260099-13260121 CTGGAGGAAGAGGGGGAAGGAGG + Intergenic
950542067 3:13618696-13618718 CTGGGGGCAGAGGGGGTAGAAGG - Intronic
950883658 3:16344490-16344512 TAGTTGGGCGAGGGGGAAGAAGG - Intronic
952362107 3:32641058-32641080 CAGTGGGAAGAGGATGGAAAGGG + Intergenic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
953293691 3:41691376-41691398 CAGTTGGAAGAGGGCCAAGTGGG - Intronic
953487771 3:43318193-43318215 CCGTGGGAAAATGGGGAGGAAGG + Intronic
953494127 3:43371979-43372001 CAGTGAGTAGAGGGGCAGGAAGG + Intronic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
953637479 3:44675514-44675536 AAGTGGGAAGTAGGGGAACAGGG + Intergenic
953903694 3:46857694-46857716 AGGAGGGAAGAAGGGGAAGAAGG + Intergenic
953935241 3:47036146-47036168 TATTGGGAATAGGTGGAAGAAGG - Intronic
954048178 3:47951335-47951357 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
954287747 3:49630799-49630821 GAGTTGGAAGAAGTGGAAGAAGG + Intronic
954554747 3:51508998-51509020 CAGAGGGAAGACGGGCAAGATGG + Intergenic
954587847 3:51752193-51752215 CAGATGGCAAAGGGGGAAGAAGG + Intergenic
954813460 3:53262374-53262396 AAGAGGGAAGAAGGAGAAGAAGG - Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955041186 3:55319218-55319240 CAGAGGGAAGAATGGGAAGCTGG - Intergenic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
955521530 3:59780037-59780059 CTATGGGAAGAGGGGTAAAATGG - Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
955857696 3:63291054-63291076 CAGTGGGAAAAGGGGGTAGCTGG + Intronic
956050320 3:65240986-65241008 AAGTGCCAAGAAGGGGAAGACGG - Intergenic
956185361 3:66557233-66557255 GAGTGGGTAGATGGGGAAAAGGG + Intergenic
956455362 3:69415459-69415481 TAGAGGGCAGAGGGGGAAGAGGG - Intronic
956547785 3:70425013-70425035 GAGAAGGAAGAGGAGGAAGAAGG + Intergenic
956665416 3:71637543-71637565 GAGGGGGAGGAGGGGGAAAAGGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956846536 3:73188825-73188847 GAGGGGGAGGAGGAGGAAGAAGG - Intergenic
957428943 3:80076637-80076659 CAGTTGGAAGAGGGCCAAGCAGG - Intergenic
957652921 3:83032539-83032561 AAGAGGGAAGAGGAGGGAGAAGG - Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
957741664 3:84278659-84278681 CAGCTGGAGGAAGGGGAAGAGGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958151271 3:89697369-89697391 CAATTGGAAGAGGGCCAAGAGGG - Intergenic
958843627 3:99239067-99239089 GAGTGGGGGGAGGGGGAGGATGG - Intergenic
959201882 3:103255911-103255933 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960204978 3:114886066-114886088 GAGTGGGTAGAGGGAGCAGAAGG - Intronic
960388474 3:117050031-117050053 CCGTGGGGAGAGGGAGACGAGGG - Intronic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
960985721 3:123279349-123279371 GAGAGGGAAGGGGAGGAAGACGG - Intergenic
961014286 3:123455497-123455519 CTGAGGCACGAGGGGGAAGATGG - Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961345315 3:126260207-126260229 GAGAGGGAAGAGGGGGAGGGAGG - Intergenic
961416587 3:126763311-126763333 GAGGGAGAAGAGGGGGAAAAAGG - Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
961642183 3:128371627-128371649 CAGTGGGCACATGGGGAGGAGGG + Intronic
961956633 3:130810874-130810896 AATTGGGAAGAGGGAGAAGCTGG + Intergenic
962002942 3:131318105-131318127 AAGGAGGAAGAGGGGAAAGAGGG + Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962281142 3:134052778-134052800 CTGTGTGAAGCGGTGGAAGAAGG + Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
962907151 3:139814333-139814355 CAGTGGGAGGTGGGGCAATAAGG + Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963814871 3:149818434-149818456 CACTGGGAGGAAGGGGAAAAGGG - Intronic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
965551149 3:169966643-169966665 CGGAGGGAAGAGGGGAGAGAAGG + Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966218560 3:177527800-177527822 CACTTGGAAGAGGGCCAAGAGGG - Intergenic
966270385 3:178097755-178097777 CAAAGGGAAGTGGGGAAAGAAGG - Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966889389 3:184395606-184395628 CTGAGGGAAGGTGGGGAAGAGGG + Intronic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967694610 3:192515641-192515663 CAGTGGGAAGTGGAGCTAGAAGG + Intronic
967827146 3:193886116-193886138 CAGTTGGAAGAGGGCCAAGTGGG - Intergenic
967856286 3:194119954-194119976 CAAGGGGAAGAGGAGGGAGATGG - Intergenic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968889287 4:3359175-3359197 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
968944640 4:3657260-3657282 GAGAGGGAAGAGGGGGACCAGGG - Intergenic
969260228 4:6028688-6028710 CCCTGGGAAGAGGAGGTAGAAGG - Intronic
969454859 4:7295065-7295087 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
969495301 4:7522992-7523014 AAGAGGGAAGAGTGGGAGGAAGG - Intronic
969542925 4:7804946-7804968 CACTGCGAAGAGTGGGAAGGAGG - Intronic
969675633 4:8612877-8612899 GCATGGGAAGAGGGGGCAGAAGG - Intronic
969685570 4:8672188-8672210 CAGTGGGGAGAGGGGATAAAGGG + Intergenic
969715339 4:8865646-8865668 CAGTGGGGAGAGGGGTCAGAAGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970192333 4:13528524-13528546 AAGTGGGTAGAGGGTGAGGAGGG + Intergenic
970914892 4:21321589-21321611 GAGGAGGAAGAGGGAGAAGAAGG + Intronic
971219696 4:24693495-24693517 GAATGGGAAGAAGGGGACGAAGG - Intergenic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
971305161 4:25473408-25473430 GAAGGGGAAGAAGGGGAAGAAGG + Intergenic
971570938 4:28209992-28210014 GAGGGGGAAGAGGGGGAGGAAGG - Intergenic
971570942 4:28210001-28210023 GAGGAGGAAGAGGGGGAAGAGGG - Intergenic
971570952 4:28210028-28210050 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971570959 4:28210046-28210068 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971633795 4:29031232-29031254 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
971893998 4:32566060-32566082 CAGTGAGAAGATGGGAAACATGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972205760 4:36770786-36770808 CAGAGAGGAGATGGGGAAGAGGG - Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972309536 4:37867140-37867162 CAGTGGAAAGATGGGGAGCAAGG - Intergenic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
973893016 4:55386772-55386794 AATTGGGAAGTGGGGCAAGATGG + Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974204392 4:58681843-58681865 CACTTGGAAGAGGGCCAAGAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975195029 4:71514320-71514342 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
975485450 4:74930534-74930556 CAGTTGGAAGAGGCCTAAGAGGG + Intergenic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
975603253 4:76125692-76125714 GAGGGAGAAGAGGGAGAAGAGGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976579500 4:86719120-86719142 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
976607238 4:86995297-86995319 CCGTGGGGAGAGGGGGAGGGAGG - Intronic
976703389 4:87995519-87995541 CAGGAGGAGGAGGGGGAAAAGGG + Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978273379 4:106918319-106918341 CAATGGGAAGAGGTTGAAAATGG - Intergenic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
978404481 4:108364734-108364756 AGGTGGGAAGATGGGGAAGCAGG - Intergenic
978886262 4:113769774-113769796 GTGGGGGAAGTGGGGGAAGAAGG - Intergenic
979125203 4:116962674-116962696 CAGTCAGAAGCGGAGGAAGAGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979529591 4:121755031-121755053 CAGTTGGAGGTGGGGGATGAGGG + Intergenic
979532843 4:121787438-121787460 GAGTGGGAAAAGGATGAAGATGG - Intergenic
980096236 4:128494004-128494026 AAGAAGGAAGAGGGGGAGGAGGG - Intergenic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
980299689 4:130972808-130972830 CAGTGGGTAGAAGGGAGAGATGG + Intergenic
980479461 4:133368883-133368905 CAGGGAGAAGTGGGGGAAGAGGG + Intergenic
981113916 4:140967874-140967896 CTGTGGTAAGAGGGGAAGGAAGG + Intronic
981197181 4:141935078-141935100 CAGGAGGAAAAGGGAGAAGATGG + Intergenic
981259926 4:142707565-142707587 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
981471798 4:145143868-145143890 CAGTAGGAAGAAGTGGAAGAAGG - Intronic
981525658 4:145704877-145704899 CACTTGGAAGAGGGTGAAGCAGG + Intronic
981732149 4:147910923-147910945 AAGAAGGAAGAGGGGTAAGAAGG - Intronic
982077455 4:151751909-151751931 CCGTTGGAAGAGGAGGAAGGTGG - Intronic
982226248 4:153170136-153170158 GAGGAGGAAGAGGGGGAAAAGGG + Intronic
982869144 4:160553745-160553767 CAGTGGGAAGGGGAGCTAGAAGG + Intergenic
983192755 4:164772217-164772239 CAGCAGGAAGAGGGAGAAGGGGG + Intergenic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
983580648 4:169306397-169306419 CATTTGGAAGAGGGGAAGGAGGG + Intergenic
983624769 4:169791368-169791390 CATTGGAAAGACTGGGAAGATGG - Intergenic
984825876 4:183924307-183924329 CAGTGGGATGAGGGTGATGATGG + Intronic
984858861 4:184219286-184219308 CAGAGGGCAGAGGTGGAAGAGGG - Intronic
985508415 5:298440-298462 CAGTGGGAAGAAGGAGGGGACGG + Intronic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985625066 5:981600-981622 GAGGGGGCAGAGTGGGAAGAAGG + Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985635117 5:1032092-1032114 CAGTGGGCAGGCGGGGGAGATGG - Intronic
985739631 5:1607228-1607250 CAGTGGGAAGAAGGAGGGGACGG - Intergenic
986538064 5:8813413-8813435 CACTTGGAAGAGGGCCAAGAGGG - Intergenic
986574455 5:9197556-9197578 CAGTTGCAACAGGGGCAAGAGGG + Intronic
986671326 5:10145588-10145610 CAGCCAGAAGATGGGGAAGAGGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
987704939 5:21450779-21450801 CATTGGGAGGAGGGGGAATTAGG - Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988250346 5:28749179-28749201 CAGTGGGAAGAGGGCAGTGAAGG - Intergenic
988294141 5:29333020-29333042 CAGAGGGTGGAGGGGGAGGAAGG - Intergenic
988497764 5:31759144-31759166 CAATGGGAGGAGGTGGAGGAGGG - Intronic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989620312 5:43377622-43377644 CACTGGGATGAGGAGAAAGAAGG + Intronic
991510061 5:67366131-67366153 GAGTGAGAAGAGGAGTAAGAAGG + Intergenic
991992675 5:72356876-72356898 TATTTGGAAGAGGTGGAAGAGGG + Intronic
992023410 5:72647646-72647668 CAGTGAGATGAGGGGGAGGGAGG + Intergenic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992552144 5:77868984-77869006 CACTGGGGAGAAGGGGAAGCTGG + Intergenic
992705464 5:79387003-79387025 AAGAAGGAAGAGGGGGAAGGGGG - Intronic
992829978 5:80584651-80584673 AAGTGGGAAGAGGGGGAGGCTGG + Intergenic
993005743 5:82426500-82426522 CACTGGGAAGAGGAGAAAGCAGG + Intergenic
993501702 5:88673825-88673847 GAGAGGAAAGAAGGGGAAGAAGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993735982 5:91477273-91477295 CAGTAGGAAGAGGAGGAAGTGGG - Intergenic
993749024 5:91643724-91643746 GAGGGGGAAGAGGGGAAAGAAGG + Intergenic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995455666 5:112349197-112349219 AAATGGGAAAAGGGGGAATAAGG + Intronic
996075218 5:119185093-119185115 CAGAGGAAAGAAGGGGAAGAAGG - Intronic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996297232 5:121935482-121935504 CAGTAGGCAGAGGCAGAAGAAGG - Intergenic
996365558 5:122696904-122696926 AAGAGAGAAGTGGGGGAAGAAGG + Intergenic
997242198 5:132315615-132315637 CAGGGTGAAGAAGGGTAAGAGGG + Intronic
997297336 5:132776570-132776592 CAGAGGGGAGCGGGGGAGGAAGG + Intronic
997476306 5:134144547-134144569 CAGTGGGAAGAATGGGAGGGAGG - Intronic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998265118 5:140662181-140662203 CATTGAGAAGAGGAAGAAGATGG + Exonic
998383535 5:141742705-141742727 CAGTGGGAAGTGGGAGGGGAGGG + Intergenic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998734670 5:145122966-145122988 GAGAGGGAAGAAGGGCAAGAAGG - Intergenic
998874523 5:146586026-146586048 CAGGGGGAAGAGGTGGATGAAGG + Intronic
998885213 5:146686898-146686920 CAGCGGGAGGTTGGGGAAGAAGG + Intronic
998937085 5:147240836-147240858 AAATGGGAAGAGAGGGAAAAAGG - Intronic
999154872 5:149450907-149450929 CAGAAGGAAGAGGGGATAGAAGG - Intergenic
999284395 5:150385627-150385649 GAGTGGGGAGAGGGGGCTGATGG - Intronic
999563665 5:152833557-152833579 CAGGGGGAAGAGGGTAAAGGGGG + Intergenic
999652641 5:153782767-153782789 CAGGCGGAAGACGGGGAGGAAGG + Intronic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
999979657 5:156945600-156945622 CAGTGGGAAGAGAGGAAGTAGGG + Intronic
1000194268 5:158942850-158942872 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000235930 5:159360561-159360583 CAGAGGGAAGAGTGGGAGGGAGG + Intergenic
1000444181 5:161299644-161299666 AAGGAGGAAGAGGAGGAAGAGGG - Intronic
1000489833 5:161897672-161897694 GAGAGAAAAGAGGGGGAAGATGG + Exonic
1000513855 5:162216285-162216307 TAGTGTAAAGAGGGTGAAGAGGG - Intergenic
1001133015 5:169079928-169079950 CAAAGGGAAGAGAGAGAAGAGGG + Intronic
1001161998 5:169327577-169327599 CAGGGGGAAGGGTGGGAGGAGGG + Intergenic
1001293659 5:170484165-170484187 CAGTGGGGAGAGGGTGTGGAAGG - Intronic
1001483487 5:172104139-172104161 CAGTGGCAGGAAGGGGAGGAAGG - Intronic
1001525282 5:172424355-172424377 CTGTGGGTAGAGGGGAATGAGGG + Intronic
1001528340 5:172444942-172444964 CTGTGGGTAGAGGGGCCAGAAGG - Intronic
1001724890 5:173888448-173888470 GAGGAGGAAGAGGAGGAAGAAGG + Exonic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002137413 5:177116543-177116565 CAGGAGGAAGATGAGGAAGAGGG + Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003269036 6:4591286-4591308 CAGAGGGAAGAGTGTGAAGCAGG - Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003511585 6:6785710-6785732 CAAGGGGAAGGGGGAGAAGAGGG + Intergenic
1003516297 6:6821600-6821622 ACGGGGGAGGAGGGGGAAGAGGG + Intergenic
1003616735 6:7661094-7661116 CAGTGGCAAGAAGGGGAAATGGG + Intergenic
1003880735 6:10477382-10477404 CAATGGGAGGATGGAGAAGAGGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004693442 6:18012188-18012210 CAGTGGGGAGTGGGGGGAGCTGG - Intergenic
1005089178 6:22038443-22038465 CAGTGAGAGGAAGGGGAAGGAGG - Intergenic
1005108365 6:22250528-22250550 GAAGGGGATGAGGGGGAAGAGGG - Intergenic
1005463903 6:26093281-26093303 CAGTGGGAAGAGGGGCAGAGGGG + Intronic
1005896928 6:30186321-30186343 GAGGGGGATGAGGAGGAAGAGGG - Exonic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006263175 6:32894174-32894196 GAGGGGCAAGAGGGGAAAGAGGG - Intergenic
1006343367 6:33459723-33459745 CAGCGGGCAGAGGTGGAAGTTGG - Intergenic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1006945480 6:37781673-37781695 CTGTGGGAAGCTGGGAAAGAAGG - Intergenic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007482333 6:42158348-42158370 GAGGTGGAAGAGGAGGAAGAGGG - Intronic
1007692103 6:43709120-43709142 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1007692113 6:43709138-43709160 GAGGGGGAAGAGGGGAAGGAGGG - Intergenic
1007692117 6:43709147-43709169 CAGGAAGGAGAGGGGGAAGAGGG - Intergenic
1007761264 6:44134994-44135016 CTGAGGGAAGAGGGGGCAGTTGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008106480 6:47444662-47444684 CCGTGGAAAGTGGGGGGAGAGGG + Intergenic
1008174242 6:48247092-48247114 TAGTGGGAGGTGGGGGGAGAAGG + Intergenic
1008219233 6:48835591-48835613 CACTTGGAAGAGGGCCAAGAAGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008484563 6:52021738-52021760 AAGAGGGAAGAGGAAGAAGAAGG - Intronic
1008965889 6:57312056-57312078 GAGAGGGGAGAGGGGGGAGAGGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009443076 6:63705578-63705600 CGGTGGGATGAGGGGAGAGATGG - Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010196878 6:73248426-73248448 GAGAGGAAGGAGGGGGAAGAAGG - Intronic
1010386366 6:75284862-75284884 GAGAGGGAGGAGGGAGAAGAAGG + Exonic
1010758441 6:79694291-79694313 ACGTGGTAAGAGGAGGAAGAGGG - Intronic
1010971776 6:82270546-82270568 AAGTGAGAAGAGTTGGAAGAGGG + Intergenic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1011565995 6:88672549-88672571 CAGGGGGAAGTGTGGGATGAGGG + Intronic
1011939620 6:92826615-92826637 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
1012472887 6:99590776-99590798 CAGTGGGAGGAAGGCGACGAGGG - Intergenic
1012493661 6:99810952-99810974 CACTTGGAAGAGGGTCAAGAAGG + Intergenic
1012779336 6:103536775-103536797 CACTTGGAAGAGGGCGAAGCGGG + Intergenic
1013220577 6:108074289-108074311 CTGTTGGAAGAGGGGGTAGCAGG + Exonic
1013272811 6:108559442-108559464 AAGTGGGGAGAGGAGGGAGAAGG - Intergenic
1013341959 6:109223757-109223779 CAGTGGGAAGAGGCAAAGGAAGG - Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013663264 6:112320539-112320561 TAGTGGGGAGTGGGGGAAAATGG + Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014311309 6:119805491-119805513 TAGTGGGAAGAGGAACAAGAGGG - Intergenic
1014471995 6:121827537-121827559 GAGTGAGGAGAGGGGGTAGATGG + Intergenic
1014792257 6:125686749-125686771 CAGGGGGAAGAGGGAGGTGAGGG - Intergenic
1015040740 6:128715792-128715814 CAGTAGCCAGAGGGGGATGAGGG - Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017123489 6:151045395-151045417 AAGTGGAGAGAGGGGGAAAAAGG - Intronic
1017170225 6:151449642-151449664 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1017379349 6:153810450-153810472 AAGGAGGAAGAGGGTGAAGAGGG - Intergenic
1017418883 6:154251788-154251810 GACTGGGAAGAAGGGGAGGAAGG + Intronic
1017597415 6:156044372-156044394 GAAAGGGAAGAGGGGGAAAATGG - Intergenic
1017928128 6:158928111-158928133 GAGTGGGAAGAGGGTGAGGATGG - Intergenic
1017939136 6:159036105-159036127 CAGGTGGAAGAGGGGGTAGGAGG + Exonic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018108568 6:160513105-160513127 GAGTGGGGAAAGGGGGAATAGGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018528826 6:164742114-164742136 AGGTGGGAAGAGTGAGAAGATGG - Intergenic
1018571221 6:165212060-165212082 AAATGGCAAGAGGAGGAAGATGG - Intergenic
1018747440 6:166773250-166773272 GGGTGAGGAGAGGGGGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019066833 6:169309373-169309395 CACTGGGAGGAGGGGGGACATGG + Intergenic
1019320789 7:414403-414425 AAGGAGGAAGAGGGGGAGGAGGG - Intergenic
1019502890 7:1374008-1374030 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019535385 7:1526534-1526556 GAGGGGGAAGAAGAGGAAGAGGG + Intergenic
1019560574 7:1654495-1654517 CAGAGGGAAGCCGGGGAGGAGGG + Intergenic
1020035216 7:4959810-4959832 GAGTGGAAAGTGGGGGAAGTTGG + Intergenic
1020080013 7:5282169-5282191 GAGGGGGAAGATGGGGGAGAGGG + Intronic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021382610 7:19985653-19985675 CAGGAGGAAGAGGGAGAAGGGGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021694367 7:23261943-23261965 CAGTGGGAAAAGGGTGGTGATGG - Intronic
1021697123 7:23286339-23286361 GAGGGGGGAGAGGGGGAAGGAGG - Intergenic
1021697127 7:23286348-23286370 GAGTGGAAGGAGGGGGGAGAGGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021894222 7:25219128-25219150 AGGTAGGAAGAGGGAGAAGAAGG - Intergenic
1021958226 7:25847753-25847775 CAGGGAGAAGAAGGGGTAGAGGG - Intergenic
1022031082 7:26492431-26492453 CAGTGGGAAGGGGAGAATGAGGG + Intergenic
1022228379 7:28387630-28387652 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
1022473389 7:30695046-30695068 AACGGGGAGGAGGGGGAAGAGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023319335 7:38976202-38976224 CAGTGGGAAGTTGCGGAGGAGGG - Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023529786 7:41140408-41140430 AAGGTGGGAGAGGGGGAAGAGGG - Intergenic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023766604 7:43517426-43517448 CAAGGGGAAGTGGGGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024242299 7:47445022-47445044 TATTGGGAAGAGGGGCAGGAAGG + Intronic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024921170 7:54556423-54556445 CATTGGGAGGAGGGAGATGAGGG + Intronic
1025110743 7:56214104-56214126 CAAGGGGAAGAGTGGGAAGGGGG - Intergenic
1025852668 7:65257404-65257426 CCGTGGGGAGAGGGAGACGAGGG - Intergenic
1026391416 7:69906381-69906403 GAGTGGGAAGTGGGAGGAGATGG + Intronic
1026433614 7:70373150-70373172 CAGGGGGGAGTGGGGGAAGAAGG + Intronic
1026456257 7:70575166-70575188 CAGTGAACAGATGGGGAAGATGG - Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026674570 7:72418108-72418130 GAGAGGGAAGAGGGGGAGGGGGG - Intronic
1026795905 7:73365955-73365977 GAGTGGGAAGAGGGGCAGGACGG - Intergenic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027529481 7:79312887-79312909 CGGTGGGTGGAGGGGGAGGAGGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028428754 7:90722107-90722129 AAGGGAGAAGAGGGGTAAGAGGG - Intronic
1028428762 7:90722133-90722155 AAGGGGGAAGAGGGGTAAGAGGG - Intronic
1028488437 7:91385196-91385218 CACTGGGGAGAGGAGGAGGAAGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028713830 7:93941137-93941159 CAGAGTGAAGAAGGGAAAGAAGG - Intergenic
1029177957 7:98678283-98678305 CAGAGGGAAGAAGGGGAGCAGGG + Intergenic
1029339220 7:99929399-99929421 CAGCGGGGAGAGGGGGTGGAAGG + Exonic
1029374745 7:100170977-100170999 CAGTGGGAAAATGGGGGAGGGGG - Intronic
1029420454 7:100469333-100469355 CACTGGGAAGAGGAGCAACAGGG + Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1029941235 7:104482767-104482789 CAGTGGGAAAAGGTGGCATATGG - Intronic
1030067849 7:105674140-105674162 CAGTGGGTAGGAGGTGAAGAGGG - Intronic
1030305192 7:108010761-108010783 CCCTGGGAAGATGGGTAAGATGG + Intergenic
1030346364 7:108437274-108437296 GAGTGGGAAGTGGGGGAAATGGG + Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030414803 7:109229786-109229808 CAGTTGGAAGAGGGCCAAGCAGG + Intergenic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030706503 7:112698038-112698060 CCGTGGGAAGAGGGAGAGGGAGG + Intergenic
1031854634 7:126907312-126907334 AAGAGGAAGGAGGGGGAAGAAGG + Intronic
1031854638 7:126907321-126907343 GAGGGGGAAGAAGGGGAAGGAGG + Intronic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1032248919 7:130236238-130236260 AACTGGGAAGATGTGGAAGAAGG + Intergenic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032412375 7:131706125-131706147 TTGCAGGAAGAGGGGGAAGACGG - Intergenic
1032550144 7:132777330-132777352 CACTGGGAAGCTGGGGAAGAGGG - Intergenic
1032569344 7:132983980-132984002 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1032928505 7:136637891-136637913 TGGTGGGAAGAGGGGAGAGAAGG - Intergenic
1033150838 7:138913851-138913873 AAGGGGGAAGAGTGGCAAGAAGG + Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033363143 7:140652063-140652085 GGGTGGGAAGAGGGGTAAGGAGG + Intronic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033733734 7:144202247-144202269 TAGTGGTAAGAGTGGTAAGATGG + Intergenic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033749316 7:144348726-144348748 TAGTGGTAAGAGTGGTAAGATGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034168277 7:149042643-149042665 GAGGGGGGAGAGGAGGAAGAGGG + Intergenic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034213385 7:149384108-149384130 CCCTGGGAAGAGTGGGAAGTTGG - Intergenic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1034955739 7:155333336-155333358 GAGTGAGAACACGGGGAAGAAGG + Intergenic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035368185 7:158361890-158361912 AGCTGGGAAGAGGGGGATGAGGG - Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035495991 7:159326607-159326629 CAAAGGGAAAAGGGGGAAGACGG - Intergenic
1035683925 8:1508802-1508824 CCCGGGGAAGACGGGGAAGACGG + Intronic
1036448745 8:8846333-8846355 GAGGGGGAGGAGGGGGAGGAGGG + Intronic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1036726374 8:11224460-11224482 CAGGAGGAAGAGGGAGAAGGAGG + Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037041683 8:14244198-14244220 AAGAAGGAAGAGGAGGAAGAAGG - Intronic
1037209354 8:16366890-16366912 AAGAGGGGAGAGTGGGAAGAGGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1037764827 8:21766187-21766209 CAGTGGGAAGATGAGGGAAATGG - Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1037950244 8:23014844-23014866 GAATGGGAAGGGGTGGAAGATGG + Intronic
1038217123 8:25572710-25572732 CGGTGGGAAGTGGAGCAAGATGG + Intergenic
1038234326 8:25737225-25737247 GAGTAGGAAGAGGAGGATGAAGG - Intergenic
1038284955 8:26198475-26198497 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1041023694 8:53662365-53662387 CAGGGGGAAGAGGAGGAAATTGG + Intergenic
1041107825 8:54459030-54459052 CAGTGGAAGGAAGGGGGAGAGGG - Intronic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041215403 8:55595549-55595571 CAGTGGGATGAGGAACAAGAGGG - Intergenic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041374893 8:57203441-57203463 CAGTTGGAAGAGGGCGAAGCGGG + Intergenic
1041376057 8:57210167-57210189 CAGTTGGAAGAGGGCGAAGCGGG + Intergenic
1041378008 8:57221910-57221932 CAGTTGGAAGAGGGTGTAGTGGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041698566 8:60763002-60763024 CAGGGGGAGGTGGGAGAAGATGG + Intronic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041796891 8:61754336-61754358 AAGAGGGAGGAGGGGAAAGAAGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042130421 8:65582446-65582468 GAAAGGGAAGAAGGGGAAGAGGG + Intergenic
1042179110 8:66067180-66067202 CGGTGGGAAGTGGGGGAGGGTGG - Intronic
1042703992 8:71647405-71647427 AAGTGGGAGGAGGGTGAGGATGG + Intergenic
1042823056 8:72952754-72952776 CTGAGGGAAGAGGGTGAAGAGGG - Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1042949791 8:74189173-74189195 GAGAGGGAAGTGGGAGAAGAAGG - Intergenic
1042963492 8:74327004-74327026 CATTAGGAAGAGGAGGCAGAGGG - Intronic
1043099382 8:76021300-76021322 CAGGAGGAAGAGGAAGAAGAGGG - Intergenic
1043355614 8:79408841-79408863 GAGAGGGCAGAGGGGGATGAGGG - Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044014199 8:87030930-87030952 GAGGGGGAGGAGGGGGAAGGGGG - Intronic
1044090330 8:87992536-87992558 GAGTAGGAAGAGGAGGAGGAGGG - Intergenic
1044402242 8:91786174-91786196 CAGCAGCAAGAAGGGGAAGAAGG - Intergenic
1044435140 8:92153061-92153083 CAGCAGGAAGAGGGAGATGAAGG - Intergenic
1044601694 8:94011676-94011698 GAGTGGGGAGGTGGGGAAGAGGG + Intergenic
1044836057 8:96296943-96296965 CACTGGGAAGCAGGGAAAGAAGG - Intronic
1045344121 8:101279480-101279502 CAATGGGGAGCAGGGGAAGAGGG - Intergenic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045458166 8:102402584-102402606 AAGTGAGAAGTGGAGGAAGATGG - Intronic
1046111355 8:109729788-109729810 AAGGAGGAAGAGGGGGAGGAGGG + Intergenic
1046194797 8:110847432-110847454 CAGTGGGGAGGGGTGGATGAAGG + Intergenic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048007613 8:130431953-130431975 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048370842 8:133774899-133774921 CAGGGGGAAGGTGGGGAACATGG - Intergenic
1048432044 8:134379478-134379500 CAGTTGGAAGAGGGCCAAGCGGG - Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048727768 8:137406552-137406574 CAGAGGGAAGAGGAGGTAAAAGG - Intergenic
1048855745 8:138685293-138685315 CAGGGTGCAGCGGGGGAAGAAGG - Exonic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049122069 8:140747772-140747794 AAGGAGGAAGAGGGGGAGGAAGG + Intronic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049194337 8:141307532-141307554 GAAGGGGAAGAAGGGGAAGAAGG + Intronic
1049210771 8:141385469-141385491 CAGAAGGAAGAAGGGGAGGAGGG - Intergenic
1049233296 8:141495284-141495306 CAGGGGGCAGAGGGGGAGGGTGG - Intergenic
1049390101 8:142363371-142363393 CAGTGGGAACCAGGGGGAGAGGG + Intronic
1049451796 8:142666007-142666029 CAGAGGGGAGAAGCGGAAGAGGG - Exonic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1049613967 8:143568319-143568341 GGGTGGGAAGAGGGGGAGCAAGG + Intronic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1049695975 8:143984496-143984518 CAGTAGGAGGAGGGGGCTGAAGG + Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049963174 9:755745-755767 CAGTGGGAACAGGCTGGAGATGG - Intergenic
1050039575 9:1475312-1475334 CAGTGGGATGAGGAGCAAGTGGG - Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051447811 9:17159668-17159690 AACTGGGAACAGGAGGAAGAGGG + Intronic
1052050912 9:23849245-23849267 AAGTGGGATGAATGGGAAGAGGG + Intergenic
1052051156 9:23850873-23850895 CATAGGGAGGTGGGGGAAGAGGG - Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053825825 9:42023223-42023245 CATTTGGAAGAGGGGCAAGCCGG - Intronic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1054604738 9:67164170-67164192 CATTTGGAAGAGGGGCAAGCCGG + Intergenic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055092221 9:72374559-72374581 CAGGGGATAGAGGGGAAAGAGGG + Intergenic
1055135517 9:72824600-72824622 CAGTTGGTAGAGGGGAGAGACGG - Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056160706 9:83889594-83889616 AACTGGGAAGATGGGGAAGAGGG - Intronic
1056359435 9:85839730-85839752 AACTGGGAAGATGGGGAAGAGGG + Intergenic
1056361282 9:85860325-85860347 CAGTGGGAAGCTGGGGAGGCAGG - Intergenic
1056513363 9:87327130-87327152 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1057040954 9:91847073-91847095 CGGGGGGAAATGGGGGAAGATGG + Intronic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1057936002 9:99239468-99239490 CACAGTGAAGAGGGGGAACAAGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058679879 9:107431521-107431543 CAGTGACAAGAGGGAGAGGAGGG - Intergenic
1058784635 9:108374968-108374990 CAGTGGGGAGAGGGGAAATGGGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059243886 9:112833194-112833216 CAGCTGGAAGAGGGGGAATAGGG - Intronic
1059269230 9:113061584-113061606 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059270366 9:113067033-113067055 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059271502 9:113072483-113072505 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059272633 9:113077927-113077949 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059273768 9:113083369-113083391 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059274902 9:113088815-113088837 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059305512 9:113350296-113350318 CAGGGGGAAGAGGCGAAAGGAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059499773 9:114741643-114741665 TAGGGGGAAGAGTGGGAAGGGGG + Intergenic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1059670484 9:116486425-116486447 AAGAGGGAAGAAGGGCAAGAGGG + Intronic
1059730213 9:117049650-117049672 CACTGGGAAGAGGAAGAGGAAGG + Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1061022175 9:128023058-128023080 CAGAGGGTAGAGGAGGAAGTGGG - Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061246192 9:129402237-129402259 GAGAGGGAAGAGGGTGAAGGAGG - Intergenic
1061250476 9:129423395-129423417 CAGGGGGCAGTGGGAGAAGAGGG + Intergenic
1061370727 9:130196001-130196023 CTCTGGGAGGAGGGGGAAAATGG + Intronic
1061404812 9:130387659-130387681 CAGTGGGAAGAACGGGCTGAGGG + Intronic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1061888498 9:133605491-133605513 CAGGTGGCAGAGGTGGAAGAAGG - Intergenic
1061899699 9:133666565-133666587 AGGAGGGAAGAGGGGGAGGAAGG - Intronic
1062059496 9:134487367-134487389 CAGGGAGAAGGGGGGCAAGAGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062362604 9:136194748-136194770 GGGAGGGAAGAGGGGGAAGAGGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185765567 X:2723343-2723365 CACAGGAAAGAAGGGGAAGAGGG + Exonic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1186803679 X:13118262-13118284 CTTTAGGAAGAGGGGGGAGAGGG - Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187036438 X:15545298-15545320 CACTTGGAAGAGGGCCAAGAGGG + Intronic
1187146195 X:16639602-16639624 CACTGGGCAGTGGGGGAAGAGGG - Intronic
1187245616 X:17550696-17550718 AGGTGGGCAGAGGGGGAAGTGGG - Intronic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187602938 X:20851958-20851980 CACTAGGAAGATGGGGAAGGAGG - Intergenic
1187675319 X:21710735-21710757 AACTGTGAAGAGGGGGAAGCTGG + Intronic
1188133506 X:26466931-26466953 CACTTGGAAGAGGGCCAAGAAGG - Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188433135 X:30129561-30129583 TGGGGGGAAGAGGGGGAAGAGGG + Intergenic
1188601633 X:31973527-31973549 CAGTGGGGAGAAGAGGAGGATGG - Intronic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1189243011 X:39540329-39540351 AAGTGGGAAGAGGAAGAAGCTGG + Intergenic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190209047 X:48429749-48429771 CAGAGGGCAGAGGGAGAAGTAGG + Intergenic
1190397149 X:49996830-49996852 CAGAGAGAAGAGGGTGAATAAGG - Intronic
1190430911 X:50377024-50377046 CAGTGGGTAGAGGGGAAGGAGGG + Intronic
1190730617 X:53223309-53223331 CAGTGGGTAGAGGGTCAGGAAGG - Intronic
1190741105 X:53289331-53289353 CAGTGGGGAGCTGGGGAAGTTGG - Intronic
1190762442 X:53447845-53447867 CAGGAGGAAGAGGGGAAAGAGGG - Intergenic
1190820130 X:53966217-53966239 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1190939565 X:55027413-55027435 CAGGGGGATGAGGGTTAAGAGGG + Intronic
1191006228 X:55714144-55714166 AAGTGGGGAGATGGGAAAGAGGG - Intergenic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191069171 X:56381176-56381198 CCGTGGGGAGAGGAGGGAGAGGG + Intergenic
1191214167 X:57918829-57918851 CACTGAGCAGAAGGGGAAGAAGG - Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192456823 X:71283242-71283264 AAGTGGAAAGAGGGAGAGGAAGG - Intronic
1192796956 X:74431903-74431925 CAGTGGGGAGATGGAAAAGATGG - Intronic
1193603827 X:83541796-83541818 CTGTGGAAAGAGGGCCAAGAGGG + Intergenic
1194310556 X:92301099-92301121 CAGTGGGGAGAGGGTGCAGTTGG + Intronic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1194364915 X:93003339-93003361 AAGTGGAAAGATGCGGAAGAAGG - Intergenic
1194411282 X:93561746-93561768 GAGTGGGAAAAAGAGGAAGAAGG - Intergenic
1194879099 X:99227667-99227689 CAGAGAGAAAAGGGAGAAGAAGG + Intergenic
1195082552 X:101385268-101385290 GAGTGGGAAGAGGAGGAGGTTGG + Intronic
1195141562 X:101965508-101965530 GAGTTGGGAGAGGGGGAAAATGG - Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195533337 X:105982467-105982489 CAGTGGGGAGAGGGAGAGGCTGG + Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195613547 X:106895169-106895191 CAGGGGTGAGAGGGGGATGAGGG - Intronic
1196000305 X:110776737-110776759 CAGTGGTAACAGGGGGTATATGG - Intronic
1196031316 X:111097308-111097330 TGGTGGGAAGAGGGGGATGCAGG + Intronic
1196131286 X:112159756-112159778 CATTTGGAAGAGTGGGGAGACGG - Intergenic
1196577374 X:117335176-117335198 CAGAGGGAGGAGGGAGAAGGGGG - Intergenic
1196865202 X:120065075-120065097 CAGGGGGCAGAGGAGGAAGCAGG + Intergenic
1196877891 X:120171205-120171227 CAGGGGGCAGAGGAGGAAGCAGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197070311 X:122288957-122288979 TAGGGGGAAGAGTGGGAAGGAGG + Intergenic
1197308281 X:124871132-124871154 AAGGGGGAAAAGGGAGAAGATGG - Intronic
1197455493 X:126673204-126673226 CCGTGGGGAGAGGGAGACGAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1198922710 X:141748508-141748530 AAGTAGGAAGTAGGGGAAGAAGG + Intergenic
1199240959 X:145546711-145546733 CAGGGCCAAGAGGGGGAAAAGGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199474512 X:148230980-148231002 GAGAGGGAAGAGGGAGAGGAAGG - Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic
1200133255 X:153862728-153862750 CAGTGGCAAGAAGGAGAAGGAGG - Exonic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic
1200618839 Y:5415385-5415407 CAGTGGGGAGAGGGTGCAGTTGG + Intronic
1201461734 Y:14233013-14233035 GAGAGGGAGGAGGGGGGAGAAGG - Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic
1202274212 Y:23098806-23098828 CACTTGGAAGAGGGGCAAGCGGG - Intergenic
1202291814 Y:23321871-23321893 CACTTGGAAGAGGGGCAAGCGGG + Intergenic