ID: 1039369497

View in Genome Browser
Species Human (GRCh38)
Location 8:36970556-36970578
Sequence CAGTTCTCCTCCTCCTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039369497_1039369502 7 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369502 8:36970586-36970608 AGCAAAGGGAGTTAGAGGATTGG No data
1039369497_1039369501 2 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369501 8:36970581-36970603 AGACAAGCAAAGGGAGTTAGAGG No data
1039369497_1039369499 -8 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369499 8:36970571-36970593 GAGAACTGGAAGACAAGCAAAGG No data
1039369497_1039369504 17 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369504 8:36970596-36970618 GTTAGAGGATTGGATGGCCATGG No data
1039369497_1039369503 11 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369503 8:36970590-36970612 AAGGGAGTTAGAGGATTGGATGG No data
1039369497_1039369500 -7 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369500 8:36970572-36970594 AGAACTGGAAGACAAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039369497 Original CRISPR CAGTTCTCCTCCTCCTCCAC TGG (reversed) Intergenic