ID: 1039369503 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:36970590-36970612 |
| Sequence | AAGGGAGTTAGAGGATTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039369497_1039369503 | 11 | Left | 1039369497 | 8:36970556-36970578 | CCAGTGGAGGAGGAGGAGAACTG | No data | ||
| Right | 1039369503 | 8:36970590-36970612 | AAGGGAGTTAGAGGATTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039369503 | Original CRISPR | AAGGGAGTTAGAGGATTGGA TGG | Intergenic | ||