ID: 1039369503

View in Genome Browser
Species Human (GRCh38)
Location 8:36970590-36970612
Sequence AAGGGAGTTAGAGGATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039369497_1039369503 11 Left 1039369497 8:36970556-36970578 CCAGTGGAGGAGGAGGAGAACTG No data
Right 1039369503 8:36970590-36970612 AAGGGAGTTAGAGGATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039369503 Original CRISPR AAGGGAGTTAGAGGATTGGA TGG Intergenic